Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

45 results about "Alpha sma" patented technology

Application of sinomenine or pharmaceutically acceptable salt thereof as medicament for preventing and treating pulmonary interstitial fibrosis

The invention relates to application of sinomenine as a medicament for preventing and treating pulmonary interstitial fibrosis. The medicament is prepared by sinomenine or pharmaceutically acceptable salt thereof and other adjuvants, wherein sinomenine or pharmaceutically acceptable salt thereof serves as an activating agent. The routes of administration of the medicament include intravenous drip, intramuscular injection, oral administration, transdermal absorption, atomization inhalation and bronchoalveolar lavage. Experiments show that sinomenine does not have obvious difference with the dexamethasone control group in the effect on inhibiting formation of bleomycin-induced pulmonary fibrosis in mice and prove that sinomenine can alleviate pulmonary alveolitis and fibrosis degrees of themice with bleomycin-induced pulmonary fibrosis and the mechanisms are probably realized by inhibiting expressions of TGF (transforming growth factor)-beta1 and alpha-SMA (smooth muscle actin) and thecontent of HYP (hydroxyproline).
Owner:李蕴麟

Application of obaculactone in preparation of drugs for treating pulmonary fibrosis, chronic pneumonia and chronic respiratory disease and drugs prepared from obaculactone

The invention discloses application of obaculactone in preparation of drugs for treating pulmonary fibrosis, chronic pneumonia and chronic bronchitis and a chronic obstructive pulmonary disease or asthma, and further discloses the related drugs. Obaculactone can effectively and dose-dependently improve the bleomycin-induced mouse pulmonary fibrosis damage and the inflammation symptoms generated in the pathogenic process of the mouse pulmonary fibrosis damage through oral administration. Detection on collagen synthesis shows that obaculactone can dose-dependently regulate down generation of alpha-SMA and collagen, and the effect is based on inhibition of obaculactone on a TGF-beta signal channel in the mouse pulmonary fibrosis tissue. The results show that obaculactone can be applied to multiple inflammation-mediated chronic lung diseases including the pulmonary fibrosis, the chronic pneumonia, silicosis, the chronic bronchitis, the chronic obstructive pulmonary disease and the asthma.
Owner:NANJING UNIV

Novel application of glycosyl modified polyphenol compounds

The invention discloses an application of glycosyl modified polyphenol compounds as drugs for relieving paraquat poisoning and treating pulmonary fibrosis. The glycosyl modified polyphenol compounds have the structure shown in the description. The glycosyl modified polyphenol compounds have a good oxidation resistance function and a lung protection function and have a notable protection function on lung injury caused by paraquat, and a mechanism is related with reduction of formation of oxygen radicals, relieving of oxidative stress and inflammatory reaction, increase of content of GSH in blood serum and SOD in lung tissue and reduction of content of MDA and HYP in lung tissue. The glycosyl modified polyphenol compounds can effectively inhibit bleomycin-induced pulmonary fibrosis of mice,and the mechanism is related with reduction of expression of TGF-beta 1, IL-6, alpha-SMA, P-smad2, type I collagen and type III collagen in lung tissue, increase of content of GSH and SOD in blood serum and reduction of the content of HYP in lung tissue.
Owner:天津海润家和创新医药研究有限责任公司

Application of snow chrysanthemum extract and snow chrysanthemum total flavone in preparation of drug for treating hepatic fibrosis

The invention discloses application of snow chrysanthemum extract and snow chrysanthemum total flavone in preparation of a drug for treating hepatic fibrosis. According to a cell experiment and an animal experiment, the snow chrysanthemum extract is given to a hepatic stellate cell line LX-2 and a CC14-induced hepatic fibrosis rat model separately, and a cell experiment result shows that the snow chrysanthemum extract can significantly reduce the DNA binding capacity of NF-kappa B, lower fibrosis markers alpha smooth muscle actin and cell matrix protein I type collagen and promote LX-2 cell apoptosis; an in-vivo result shows that compared with the model group, the snow chrysanthemum extract can decrease the content of AST and ALT of a hepatic fibrosis rat, decrease the content of hepatic collagen and reduce expression of the alpha-SMA and an ECM, and after hepatic tissue is subjected to ultrasonication to form homogenate suspension, it can be found that the DNA binding capacity of the NF-kappa B is significantly reduced; the snow chrysanthemum extract can be used for preparing the drug or functional food for treating the hepatic fibrosis by serving as an NF-kappa B signal channel inhibitor.
Owner:TIANJIN UNIV OF COMMERCE

Human skin tissue endogenous polypeptide PDHPS1 and application thereof

The invention discloses a human skin tissue endogenous polypeptide PDHPS1 and an application thereof. The amino acid sequence of the human skin tissue endogenous polypeptide PDHPS1 is shown in SEQ IDNO.1. The polypeptide PDHPS1 inhibits the propagation of a scar dermal fibroblast, inhibits the expression of mRNA of collagen genes COL1A1 and COL1A2 in the scar dermal fibroblast, and obviously reduces the protein expression of a main marker alpha-SMA of a myofibroblast in the scar dermal fibroblast. The human skin tissue endogenous polypeptide PDHPS1 can be used to prepare a drug or agent whichcan inhibit the propagation of the scar dermal fibroblast, reduce the collagen content and reduce the amount of the myofibroblast, and provides a new target spot for inhibiting the scar hypertrophy.
Owner:NANJING MATERNITY & CHILD HEALTH CARE HOSPITAL

Application of verbascoside in treating and preventing type II diabetic nephropathy

InactiveCN108451961AIncrease the areaIncrease the average optical density valueOrganic active ingredientsMetabolism disorderTG - TriglycerideProtein C
The invention relates to new application and a new action mechanism of verbascoside, in particular to application of verbascoside in the drugs for treating and preventing type II diabetic nephropathy,and the research on the protection function of the verbascoside for the type II diabetic nephropathy and the action mechanism thereof. Results show that the verbascoside can alleviate liver injury caused by high glucose and lower the serum creatinine, urea nitrogen and urinary microalbuminuria levels, the blood fat level (total cholesterol and triglyceride) and the fasting blood-glucose and bloodinsulin level of spontaneous diabetes db / db mice; TGF (Transforming Growth Factor)-beta 1 and the signal transduction protein Smad3 and Smad4 and alpha-SMA protein expression thereof in a kidney tissue are obviously lowered; meanwhile, the verbascoside can alleviate the liver injury caused by high glucose; HK-2 proliferation and EMT (pithelial-Mesenchymal Transition) formation can be inhibited. In conclusion, the verbascoside has an obvious protection function on the type II diabetic nephropathy, the action mechanism of the verbascoside is that the kidney protection function of the verbascoside is implemented through oxidative stress reaction regulation and control, TGF-beta / smad signaling channel inhibition and kidney fibrosis alleviation.
Owner:NANJING UNIVERSITY OF TRADITIONAL CHINESE MEDICINE

Application of astaxanthin in preparation of drugs for prevention and treatment of glomerular fibrosis and edema

The invention discloses application of astaxanthin in preparation of pharmaceutical compositions for inhibiting alpha-SMA and FN expression in prevention and treatment of glomerular fibrosis and edema, and discloses a pharmaceutical composition for prevention and treatment of glomerular fibrosis and edema. And the pharmaceutical composition is characterized by containing astaxanthin.
Owner:NINGBO UNIV

Ganolactone D, pharmaceutical composition thereof and application of ganolactone D in pharmacy and foods

The invention provides Ganolactone D (1), a pharmaceutical composition thereof and application of the ganolactone D in pharmacy and foods. The novel compound Ganolactone D is separated from ganoderma lucidum. Researches show that the Ganolactone D can restrain the expression of TGF-beta1 mediated renal tubular epithelial cell alpha-SMA, fibronectin and I-form collagen, thereby indicating that the Ganolactone D can obviously restrain the fibrosis of kidney tissues; and the researches also find that the Ganolactone D can selectively restrain the phosphorylation of TGF-beta1 mediated renal tubular epithelial cell Smad3, but has no obvious influence on the phosphorylation of Smad2, PI3K, ERK and p-38 and the protein expression of Smad4 and Smad7, and the phosphorylation of Smad3 is a common signal path mediating the fibrosis of multiple organs, thereby indicating the treatment effect of the Ganolactone D on the fibrosis of the organs including kidneys.
Owner:KUNMING INST OF BOTANY - CHINESE ACAD OF SCI +1

Ganoderma cochlear phenols A and B, pharmaceutical compositions of ganoderma cochlear phenols A and B and applications of ganoderma cochlear phenols A and B and pharmaceutical compositions in preparation of medicines and food

The invention relates to ganoderma cochlear phenols A and B, pharmaceutical compositions of ganoderma cochlear phenols A and B and applications of ganoderma cochlear phenols A and B and the pharmaceutical compositions thereof in preparation of medicines and food. Two racemates are separated from ganoderma cochlear and identified, and then the two racemates are split into two pairs of optical enantiomers which are named as levorotatory or dextrorotatory ganoderma cochlear phenols A and B respectively. Researches show that both the racemates and the enantiomers are capable of significantly inhibiting TGF-beta1-induced renal tubular epithelial cell from generating fibronectin, I type collagen and alpha-smooth muscle actin (alpha-SMA), and researches further find that both the racemates and the enantiomers are capable of significantly inhibiting the TGF-beta1-induced renal tubular epithelial cell Smad3 from phosphorylation, which means that the compounds have application prospects in the field of preparation of medicines for resisting renal fibrosis and chronic nephrosis.
Owner:KUNMING INST OF BOTANY - CHINESE ACAD OF SCI

Application and preparation method of pure magnesium/coating composite

The invention relates to application of pure magnesium / coating composite in the preparation of glaucoma drainage devices; a glaucoma drainage device made with the pure magnesium / coating composite candegrade and be absorbed by tissues autonomously; it is fully shown that the pure magnesium / coating composite can inhibit the proliferation of Tenon's capsule fibroblasts and decrease scar; magnesium ions released during degradation can protect visual nerves. Compared with traditional titanium alloy, the pure magnesium / coating composite causes significantly low cytotoxicity to the fibroblasts, andcan effectively inhibit the proliferation of Tenon's fibroblasts, reduce specific protein alpha-SMA expression and inhibit activity of the fibroblasts.
Owner:重庆医科大学附属第三医院 +1

Application of FOXM1 inhibitor FDI-6 in resistance of hepatic fibrosis

The invention discloses application of an FOXM1 inhibitor FDI-6 in resistance of hepatic fibrosis. The name of a derivative is 3-amino-N-(4-fluorophenyl)-6-(thiophene-2-ox)-4-(trifluoromethyl)thieno[2,3-b]pyridine-2-formamide; an action mechanism is expressed by inhibiting FOXM1; the expression of Collagen I and alpha-SMA is regulated down, so as to realize the corresponding hepatic fibrosis-resistant function. The caused hepatic fibrosis diseases include but not limited to chronic viral hepatitis, alcoholic hepatic diseases, non-alcoholic fatty hepatic diseases, toxin, drug-derived and autoimmunity hepatic diseases, hepatic blood stasis, inherited metabolic diseases and the like.
Owner:NANHUA UNIV

Application of wogonin in preparation of drug for treating hepatic fibrosis

The invention discloses application of wogonin in preparation of a drug for treating hepatic fibrosis. The application has the advantages that the application of the wogonin in preparation of the drugfor treating hepatic fibrosis is disclosed for the first time; the wogonin has the effects of effectively inhibiting the expression of an index protein of hepatic fibrosis in vitro, promoting the expression of an apoptosis index protein in HSC(hepatic stellate cells) and reducing the level of glutamic-pyruvic transaminase and glutamic oxalacetic transaminase and the expression of Collagen-alpha 1and alpha-SMA, therefore, the wogonin has the effect of relieving hepatic fibrosis, the mechanism of action of the wogonin is related to the effect of prompting the apoptosis of the HSC, the wogoninis wide in application prospect, and more drug choices are also provided for treatment of hepatic fibrosis.
Owner:ANHUI MEDICAL UNIV

Application of urushiol-silicon polymer in preparation of medicine for inhibiting Smad3 phosphorylation

The invention discloses an application of an urushiol-silicon polymer (code: GQ-5) in preparation of a medicine for inhibiting Smad3 phosphorylation. The in-vitro experiment shows that the urushiol-silicon polymer is able to inhibit TGF (Transforming Growth Factor) beta 1 mediated Smad3 phosphorylation and also can inhibit the expression of mRNA (Messenger Ribose Nucleic Acid) of alpha-SMA (Smooth Muscle Actine), type I collagen and fibronectin at downstream. The in-vivo experiment also shows the same result. Therefore, the GQ-5 has the effect of specifically inhibiting Smad3 phosphorylation and also can be used for preparing a medicine for inhibiting Smad3 phosphorylation.
Owner:NANFANG HOSPITAL OF SOUTHERN MEDICAL UNIV +1

Use of pterostilbene in preparing medicine for preventing and treating high uric acid nephropathy

The invention relates to use of pterostilbene in preparing a medicine for preventing and treating high uric acid nephropathy, and belongs to the field of medicine, and provides use of the pterostilbene or a pharmaceutically acceptable salt thereof in preparing the medicine for treating and / or preventing the high uric acid nephropathy. Experimental results show that the pterostilbene can significantly reduce the level of serum uric acid, inhibits renal interstitial fibrosis, can significantly reduce the expression of fibrosis-related proteins such as alpha-SMA, collagenI, collagenIV and fibronectin, has a definite therapeutic effect on the high uric acid nephropathy, and provides a new option for clinical medication.
Owner:WEST CHINA HOSPITAL SICHUAN UNIV

Anti-pulmonary fibrosis application of DDR2 small-molecule inhibitor

InactiveCN104490889AImprove pulmonary fibrosisPulmonary fibrosis remissionOrganic active ingredientsRespiratory disorderMedicineOrganism
The invention discloses an anti-pulmonary fibrosis application of a DDR2 small-molecule inhibitor, belonging to the technical field of biological medicines. In a DDR2 gene deletion mouse model, the pulmonary fibrosis condition can be remarkably improved through D856 in case of simultaneously giving bleomycin and the DDR2 small-molecule inhibitor D856; even in a homozygous mouse for restoring expressing DDR2, the inhibitor also can achieve the effect of relieving pulmonary fibrosis. On cell lever, the inhibitor D856 is added to lower the content of alpha-SMA. In an experiment of giving an inhibitor within different days, the pulmonary fibrosis also can be remarkably relieved even the inhibitor D856 is given from the 14th day, and the same result is obtained by verifying the small interference RNA of DDR2. The experimental results sufficiently support of the application of the DDR2 small-molecule inhibitor D856 to preparing an anti-pulmonary fibrosis drug and / or a health product.
Owner:FOURTH MILITARY MEDICAL UNIVERSITY

Application of oxidized resveratrol

The invention discloses an application of oxidized resveratrol in preparation of medicines and health foods for preventing and treating acute liver injury and liver fibrosis. The oxidized resveratrolbelongs to a plant natural compound, has a wide range of sources and can be extracted and separated from various parts of mulberry. Compared with the CCl4 induction group, after oxidized resveratrol treatment according to ratios of 100 mg / kg and 300 mg / kg, the test group reduces the fibrotic damage degree of animal liver and observably reduces the expression levels of alpha-SMA, TGF-beta 1, p-SMADand p-ERK1 / 2 proteins. The test results show that the oxidized resveratrol has significant liver fibrosis prevention effects. The application can guide the development of novel methods for treating liver fibrosis and provides a novel direction and strategy for the development and utilization of mulberry.
Owner:新疆农业科学院农产品贮藏加工研究所

GLI2-shRNA and application thereof

The invention discloses GLI2-shRNA and application thereof. The GLI2-shRNA has the nucleotide sequence of GATCCGTGTGGAGGACTGCCTACA TATTTCAAGAGAATATGTAGGCAGTCCTCCACATTTTTTATGTTTTTTA. The invention further discloses a carrier, a host and application. The expression of GLI2mRNA and proteins can be effectively reduced, the expression of intrahepatic biliary epithelial cells E-cadherin can be up-regulated, the expression level of Vim and alpha-SMA proteins is down-regulated, and therefore the epithelial mesenchymal transformation of the biliary epithelial cells is reversed.
Owner:SICHUAN UNIV

Use of toll-like receptor 4 agonist crx-675 against pulmonary fibrosis

The invention discloses an application of a stimulating agent CRX-675 of a Toll-like receiver 4 in resisting pulmonary fibrosis. By systematic study, the inventor discovers that a pulmonary fibrosis model is formed by injecting bleomycin (3U / Kg) into the trachea of C57BL / 6 mouse, after 7 days from model forming, CRX-675(10mg / kg / day) is injected into the abdominal cavity to the 21st day; by the histopathology and biochemical detection and other methods, when a TLR4 signal channel is activated, the death rate of the mouse injected with the bleomycin can be obviously reduced; when the TLR4 signal channel is activated, the inflammations and injuries of the lung induced by the bleomycin are obviously reduced, the pulmonary fibrosis caused by the bleomycin is reduced, the collagen deposition in the lung, the content of hydroxyproline and the expression of alpha-SMA are reduced, and the function of the lung of the mouse by pulmonary fibrosis is improved.
Owner:INST OF MATERIA MEDICA AN INST OF THE CHINESE ACAD OF MEDICAL SCI

Application of thiazolopyranone analogues in preparation of anti-liver fibrosis or anti-acute liver injury medicines

The invention provides new medical application of thiazolopyranone analogues, in particular relates to application of the thiazolopyranone analogues in preparation of anti-liver fibrosis or anti-acuteliver injury medicines. A general structural formula of the thiazolopyranone analogues is described in the description; classical pharmacology experiments confirm that the thiazolopyranone analoguescan down-regulate the expression of a smooth muscle actin alpha-SMA and a transforming growth factor (TGF)-beta 1 in human hepatic stellate cells LX-2, thereby inhibiting the proliferation and transformation of the human hepatic stellate cells LX-2. In a model experiment of CCl4-induced liver fibrosis / acute liver injury in mice, the thiazolopyranone analogues can inhibit the up-regulation of ALT and AST in the serum of the mice, and can inhibit the expression of the alpha-SMA and the TGF-beta 1 which are related to liver fibrosis; the analysis of various pathological sections and immunohistochemistry experiments also confirm that the analogues can effectively treat acute liver injury and liver fibrosis in the mice. Therefore, the thiazolopyranone compounds can be used as active substancesfor the preparation of the anti-liver fibrosis or anti-acute liver injury medicines.
Owner:LANZHOU UNIVERSITY

Application of CoQ10 in silicosis fibrosis resistance

The invention discloses an application of CoQ10 in silicosis fibrosis resistance. The application is characterized by comprising the following steps: (1) setting a control group: selecting 24 male C57mice at SPF level and 6 yearlings, wherein the weight of the mice is at 20+ / -2g, firstly adaptively feeding for one week, and then randomly dividing into a control group, a model group and a treatment group; constructing a mice silicosis model by once instilling 0.1mL of SiO2 suspension into trachea for the model group and the treatment group, and installing the normal saline with the same volumeinto the control group through the same method; giving 0.1mL of CoQ10 every day after post-operation 48h of the treatment group, performing gastric perfusion, wherein the control group and the modelgroup are in independent feeding. The application disclosed by the invention has the advantages that the CoQ10 can reduce the silicosis fibrosis induced by the SiO2, and can lower the collagen, hydroxyproline and alpha-SMA expression; the action mechanism thereof can regulate the endogenous HMGCR expression in a feedback way and influence an oxidation respiratory chain, thereby providing a new perspective for the research of the subsequent silicosis treatment mechanism.
Owner:NINGXIA MEDICAL UNIV

Application of anisodine to preparation of drugs for preventing or treating renal fibrosis

The invention belongs to the field of medicine and particularly relates to application of anisodine to preparation of drugs for preventing or treating renal fibrosis. The technical problem to be solved is to provide novel application of the anisodine, particularly application of the anisodine to preparation of the drugs for preventing or treating the renal fibrosis. Specifically, the anisodine has the efficacies of decreasing the level of Scr and BUN in serum and the level of alpha-SMA and TGF-beta protein in renal tissues and promoting or improving fibrous tissue proliferation in renal interstitium, which indicates that the anisodine is capable of protecting and improving renal interstitial fibrosis. The anisodine serving as an active ingredient is preferably selected from anisodine hydromide. Experiments prove that the anisodine hydromide is capable of preventing or treating the renal fibrosis and improving the renal fibrosis by inhibiting proliferation and activation of myofibroblasts in the renal tissues, and accordingly a novel selection for clinical prevention and treatment of the renal fibrosis is offered.
Owner:SICHUAN UNIV

Application of endometrial stem cells in preparation of drugs for preventing or treating pulmonary fibrosis

The invention discloses application of endometrial stem cells in preparation of drugs for preventing or treating pulmonary fibrosis, and belongs to the technical field of biological medicine. The medicine provided by the invention comprises endometrial stem cells, and the solvent of the medicine is an aqueous solution of sodium chloride. The medicine provided by the invention can significantly improve pulmonary fibrosis, regulate the expression levels of alpha-SMA, collagen and IL-6 in lung tissue down, regulate the expression level of IL-10 in lung tissue up, and also regulate the expressionlevel of TNF-alpha in spleen tissue down.
Owner:SOUTHERN MEDICAL UNIVERSITY +1

Small-molecule compound for inhibiting liver fibrosis and application thereof

The invention relates to a small-molecule compound for inhibiting liver fibrosis and an application thereof. A series of compounds that have inhibitory effects on the expression of PI4KA (encoded PI4KIIIalpha) or the enzyme activity of PI4KIIIalpha of primary HSC (hepatic stellate cells) are obtained by screening, and these compounds can significantly inhibit the mRNA level of PI4KA of HSC or theenzyme activity of PI4KIIIalpha to further reduce the mRNA level of alpha-SMA or type I collagen, thereby inhibiting liver fibrosis.
Owner:SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI

Expression and purification method of schistosoma japonicum SjP40 protein and application

The invention discloses an expression and purification method of schistosoma japonicum SjP40 protein and an application. The method comprises the steps of construction and identification of recombinant expression plasmid, primer design, adding of a restriction enzyme cutting site and a protective base to the two ends of the primer, PCR construction of pET-28a-SjP40 by taking pMD19-T-SjP40 as a template, expression and purification of recombinant plasmid and recombinant protein and the like. The invention also provides an application of the schistosoma japonicum P40 protein in preparing a preparation inhibiting the protein-level expression of alpha alpha-SMA and I-type collagen in the LX-2 cell and an application in preparing a preparation inhibiting the activation of TGF-beta1 induced LX-2 cells. The method disclosed by the invention is simple and easy to operate; and the invention provides a new application of the schistosoma japonicum P40 protein.
Owner:苏州美仑生物科技有限公司

Cordyceps cicadae composite medicine for treating diabetic nephropathy and preparation method thereof

The invention provides cordyceps cicadae composite medicine for treating diabetic nephropathy and a preparation method thereof and belongs to the field of traditional Chinese medicine. The cordyceps cicadae composite medicine for treating diabetic nephropathy is prepared from the following raw materials in parts by weight: 18 to 22 parts of cordyceps cicadae, 14 to 16 parts of radix rehmanniae, 14to 16 parts of common yam rhizome, 8 to 12 parts of fructus lycii, 8 to 12 parts of fructus corni, 8 to 12 parts of achyranthes root, 14 to 16 parts of fried radix astragali seu hedysari, 8 to 12 parts of radix salvia miltiorrhizae, 8 to 12 parts of poria with hostwood and 5 to 7 parts of chamomile flower. The composite medicine has scientific and rigovous compatibility and complete assistant andguide and has the effects of tonifying qi and yin, promoting blood circulation to remove blood stasis, nourishing liver and kidney and can achieve an effect of treating both symptoms and root causeson the diabetic nephropathy. Research data show that aqueous extract of the cordyceps cicadae composite medicine can effectively inhibit aldose reductase and reduce expression of TGF-beta1 protein, alpha-SMA protein and FN protein of renal tubular epithelial cells; thus, damage to the glomerulus cells is reduced, glomerular sclerosis is relieved, tubular interstitial fibrosis is inhibited, pathological change of the kidney is lightened, illness state development can be inhibited and converted, and a better treating and protecting effect on the diabetic nephropathy is achieved.
Owner:WUXI NO 2 PEOPLES HOSPITAL

New use of sugar -based decorative polyphenol compounds

The invention discloses an application of glycosyl modified polyphenol compounds as drugs for relieving paraquat poisoning and treating pulmonary fibrosis. The glycosyl modified polyphenol compounds have the structure shown in the description. The glycosyl modified polyphenol compounds have a good oxidation resistance function and a lung protection function and have a notable protection function on lung injury caused by paraquat, and a mechanism is related with reduction of formation of oxygen radicals, relieving of oxidative stress and inflammatory reaction, increase of content of GSH in blood serum and SOD in lung tissue and reduction of content of MDA and HYP in lung tissue. The glycosyl modified polyphenol compounds can effectively inhibit bleomycin-induced pulmonary fibrosis of mice,and the mechanism is related with reduction of expression of TGF-beta 1, IL-6, alpha-SMA, P-smad2, type I collagen and type III collagen in lung tissue, increase of content of GSH and SOD in blood serum and reduction of the content of HYP in lung tissue.
Owner:天津海润家和创新医药研究有限责任公司

Pharmaceutical composition with synergistic effect and myofibroblast capable of resisting organ fibrosis and tumor stroma and application

InactiveCN104873512ADoes not exhibit cytotoxicityNo apoptosisOrganic active ingredientsNervous disorderResting timeLymphatic Spread
The invention discloses a pharmaceutical composition with a synergistic effect and myofibroblast capable of resisting organ fibrosis and tumor stroma. The pharmaceutical composition is composed of tetrandrine, a tetrandrine derivative, baicalein and a baicalein derivative, has the synergistic effect and the myofibroblast capable of resisting organ fibrosis and tumor stroma, is capable of reducing expression of myofibroblast alpha-smooth muscle actin (alpha-SMA), enables the myofibroblast alpha-smooth muscle actin (alpha-SMA) to be restored to fibroblast in resting time, and is used for treating organ fibrosis and suppressing tumor growth, metastasis and infiltration. The pharmaceutical composition has no obvious toxic or side effects on fibroblast while obviously reducing expression of alpha-SMA.
Owner:魏华

Application of low molecular weight basic fibroblast growth factor lmw FGF2

The invention discloses application of a low molecular weight basic fibroblast growth factor LMW FGF2 in preparing medicament for resisting liver fibrosis. The low molecular weight basic fibroblast growth factor LMW FGF2 provided by the invention can inhibit the expression of HSCs activation marker genes alpha smooth muscle actin (alpha-SMA) and collagen type I [col I (alpha 1)], and thereby inhibiting the activation of hepatic stellate cells and decrease liver fibrosis.
Owner:HANGZHOU S EVANS BIOSCI LTD

GLI1-shRNA and application thereof

The invention discloses GLI1-shRNA and application thereof. A nucleotide sequence of the GLI1-shRNA is GATCCGCAGCATGAGCTCTGCTTACATTCAAGAGATGTAAGCAGAGCTCATGCTGCTTTTTTA. The invention also discloses a vector, a host and application. According to the invention, expression of the GLI1mRNA and a protein can be effectively reduced, expression of E-cadherin in intrahepatic bile duct epithelial cells canbe up-regulated, and protein expression levels of Vim and alpha-SMA can be down-regulated so as to reverse epithelial mesenchymal transition of the bile duct epithelial cells.
Owner:SICHUAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More