Unlock instant, AI-driven research and patent intelligence for your innovation.

GLI1-shRNA and application thereof

A technology of use and nucleotide sequence, applied in the field of GLI1-shRNA, can solve the problem of genes without Gli1mRNA and protein expression, etc.

Active Publication Date: 2019-06-11
SICHUAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] There are no relevant literatures on genes that silence Gli1 mRNA and protein expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GLI1-shRNA and application thereof
  • GLI1-shRNA and application thereof
  • GLI1-shRNA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] 1 Gene synthesis and viral vector construction

[0028] The general steps are as follows:

[0029] The first step, sequence design

[0030] According to the mouse GLI1 CDS sequence, the corresponding software was used to design the silencing sequence specifically recognizing GLI1 on the homepage of Invitrogen Company, as shown in SEQ ID NO: 1, and synthesized using the existing gene synthesis technology.

[0031] The second step is to perform double enzyme digestion on the target sequence and expression vector

[0032] The synthesized target sequence and the pLent-U6-Puro vector were double-digested, and the target sequence and linear vector were recovered using a gel recovery kit.

[0033] The third step is to connect the target sequence to the vector

[0034] The two products in the previous step were ligated, transformed and extracted under the action of T4 DNA ligase to obtain the silencing vector GLI1-shRNA.

[0035] The fourth step, lentiviral packaging

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses GLI1-shRNA and application thereof. A nucleotide sequence of the GLI1-shRNA is GATCCGCAGCATGAGCTCTGCTTACATTCAAGAGATGTAAGCAGAGCTCATGCTGCTTTTTTA. The invention also discloses a vector, a host and application. According to the invention, expression of the GLI1mRNA and a protein can be effectively reduced, expression of E-cadherin in intrahepatic bile duct epithelial cells canbe up-regulated, and protein expression levels of Vim and alpha-SMA can be down-regulated so as to reverse epithelial mesenchymal transition of the bile duct epithelial cells.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a GLI1-shRNA and its application. Background technique [0002] Biliary atresia is an inflammatory sclerosing cholangiopathy, which is the main disease leading to liver transplantation in children. Epithelial-mesenchymal transition (EMT) of biliary epithelial cells is one of the main pathological processes leading to liver fibrosis. Studies have shown that EMT plays an important role in embryonic development, tissue regeneration and repair, organ fibrosis, and cancer cell metastasis. After many tissues and organs are injured, fibrous tissue and scar tissue are formed through the EMT mechanism to achieve wound repair, but the persistence of this process can cause tissue and organ fibrosis and sclerosis, such as pulmonary fibrosis and kidney fibrosis. [0003] The Shh signaling pathway plays an important role in embryonic development, epithelial-mesenchymal and epithelial-epithelial sig...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113A61K31/7088A61P1/16
Inventor 靳曙光
Owner SICHUAN UNIV