Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

SNP marker tightly linked with irregular stripe characters of cucumber fruits, and applications thereof

An irregular, cucumber technology, applied in the fields of genetic engineering and molecular biology, can solve the problems of genetic improvement of cucumber fruit epidermis-related traits, such as difficulty in molecular marker-assisted breeding, and achieve the effects of molecular breeding, convenient identification and low reliability.

Active Publication Date: 2019-09-06
NANJING AGRICULTURAL UNIVERSITY
View PDF7 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Several genetic and regulatory mechanisms related to epidermal traits have been identified, such as cucumber ripening reticulation gene (H) and cucumber fruit mottled gene (U), but the research on the irregular stripe traits of cucumber fruit is still blank. This brings difficulties to the genetic improvement and molecular marker-assisted breeding of cucumber fruit skin-related traits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP marker tightly linked with irregular stripe characters of cucumber fruits, and applications thereof
  • SNP marker tightly linked with irregular stripe characters of cucumber fruits, and applications thereof
  • SNP marker tightly linked with irregular stripe characters of cucumber fruits, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0021] Molecular markers linked to irregular stripes of cucumber fruit were obtained by the following methods:

[0022] (1) Acquisition and Genetic Analysis of Irregular Stripes in Cucumber Fruit

[0023] The mutant ist with irregular stripes on cucumber fruit is a natural mutant found in the field. Its wild-type parent is the northern cucumber variety 'Changchun Mici', which is different from the wild-type uniform-colored fruit. Yellow-green, with dense dark green stripes at one end and sparser stripes at the other end. Use these two parental materials to configure F 1 , F 1 F 2 generation. STAT 148 F 2 The phenotype of the population was verified by Chi-square analysis, and it was concluded that the cucumber fruit irregular stripe gene was a recessive trait controlled by a single gene.

[0024] (2) Extraction of Cucumber Genomic DNA

[0025] According to the conventional method-CTAB method to extract the parents, F 1 and all F 2 Leaf total DNA of segregated populati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an SNP marker tightly linked with irregular stripe characters of cucumber fruits. The SNP marker is characterized in that the SNP marker can be tightly linked with the irregularstripe genes of cucumber fruits; the forward and reverse primer sequences of the marker respectively are 5'GACCTCCCAACCCCTGATTTTTT3' and 5'ATCGTTCGCCGTCTTACCTGACT3'; the amplification length of the marker is 675 bp, an SNP locus is located on a forward-amplified 440bp locus, and the marker has A / G polymorphism; and a GG genotype is cucumbers with irregular stripes, and AA and AG genotypes are thecucumbers with no irregular stripes. The SNP molecular marker belongs to co-dominant markers, is reliable and fast in detection and can be used for the directed genetic breeding of the related characters of cucumber fruit epidermis; and the SNP marker has important theoretical and practical guiding significance on accelerating the genetic improvement process of cucumber varieties and enhancing breeding selection efficiency.

Description

technical field [0001] The invention relates to genetic engineering and molecular biology, and belongs to the field of molecular genetic breeding. It provides a SNP molecular marker closely linked to the irregular stripe trait of cucumber fruit and its application, which can be used for the molecular marker-assisted selective breeding of the irregular stripe trait of cucumber. to increase breeding efficiency. [0002] technical background [0003] Cucumber (Cucumis sativus L.2n=2x=14) belongs to Cucurbitaceae Melon, an annual vine herb, and is one of the top ten vegetable crops in the world. Fruit epidermis characteristics are one of the most important determinants of commercial and nutritional value of cucumbers, which are rich in genetic diversity. In recent years, many genetic studies have focused on the skin characteristics of cucumber, including fruit surface color, surface texture characteristics and prickly tumor status. [0004] Fruit stripe color is one of the typi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/156C12Q2600/13
Inventor 娄群峰宋蒙飞程凤陈劲枫
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com