A kind of expression method and application of aep cyclase in Pichia pastoris
An expression method, the technology of Pichia pastoris, applied in the field of genetic engineering, can solve the problem that the expression level cannot meet the requirements of industrial production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Expression of AEP cyclase in Pichia pastoris
[0039] S1: Construction of pBDM-AEP vector
[0040] Construction principle see figure 1 .
[0041] First, the amino acid sequence of AEP was obtained from the literature, and the sequence was handed over to Wuhan Jinkairui Bioengineering Co., Ltd. for gene synthesis. Using the plasmid containing the AEP sequence provided by Wuhan Jinkairui Bioengineering Co., Ltd. as a template, BDM-AEP-F: GTCAGCACGTGATGGTGATTATCTTCATTTACCG, see SEQ ID NO: 1 and BDM-AEP-R: GGCCATTAAGGAATAGAAGCGCATGCCTGAGAGG, see SEQ ID NO: 2, for Forward and reverse primers for AEP fragment PCR amplification, the total PCR system is 100μL, including 10×pfu Buffer 10μL, dNTPs (10mmol / L) 4μL, forward primer and reverse primer 4μL each, plasmid as template: 20-30ng, and finally add pfu DNA polymerase 4μL, and finally add water to make up to 100μL. After configuring the components required for the PCR reaction, preheat the PCR instrument at 95°C f...
Embodiment 2
[0066] Example 2 Identification of cyclization ability of AEP cyclase
[0067] Step 1: Obtain the cyclization substrate of AEP cyclase
[0068] Since the SUMO protein is 11.0kDa in size, it can be well observed in SDS-PAGE and has the possibility of cyclization, so it is used as the cyclization substrate of AEP cyclase. Add GGGGSGGGGS to the N-terminal of the SUMO protease substrate, and add a longer Linker1 (GSGS), TEV protease substrate sequence (ENLYFQ / S), and a longer Linker2 (DVGGGGSEGGGSGGPGSGGEGSAGGGSAGGGS) to the C-terminal of the SUMO protease substrate in sequence and 6*His(HHHHHH), and finally add the recognition sequence of AEP cyclase at both ends to form a tandem substrate (GLP-SUMO protease substrate-Linker1-TEV protease substrate-Linker2-STRN / GLP-6*His ), the recognition sequence of AEP cyclase is shown in SEQ ID NO:5. Construct tandem substrates by overlap extension PCR, the forward primer is
[0069] SUMO-TEV-F: aactttaagaaggagatataccatgggcctgcaactgaaaggtt...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


