Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for producing sedoheptulose

A technology of sedum heptulose and trehalose synthase, which is applied in botany equipment and methods, biochemical equipment and methods, transferase, etc., can solve the problem that no one knows about sedum heptulose

Inactive Publication Date: 2020-12-04
NAGASE & COMPANY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the above-mentioned literature, although bacteria that produce sedum heptulose in nature are reported, methods for increasing the production of sedum heptulose in these bacteria are not yet known.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing sedoheptulose
  • Method for producing sedoheptulose
  • Method for producing sedoheptulose

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0039] In one aspect, the present invention relates to a method for preparing sedoheptulose, which includes: the step of cultivating bacteria that disable or attenuate the function of transaldolase.

[0040] In another aspect, the present invention relates to bacteria in which the function of transaldolase is disabled or attenuated.

[0041] In yet another aspect, the present invention relates to a method for increasing the production of sedoheptulose, the method comprising: the step of culturing bacteria that disables or attenuates the function of transaldolase.

[0042] In the present disclosure, sedoheptulose refers to the formula C 7 h 14 o 7 Indicated Sedoheptulose. The D-form and L-form are not particularly limited, but the sedoheptulose is preferably D-sedoheptulose.

[0043] In the present disclosure, transaldolase catalyzes the reversible conversion of sedoheptulose-7-phosphate and glyceraldehyde 3-phosphate into erythrose-4-phosphate and fructose-6-phosphate . ...

Embodiment 1

[0129] 1. Sedoheptulose Production Using Streptomyces

[0130] The inventor uses Streptomyces lividans ( Streptomyces lividans ) and Streptomyces avermitilis ( Streptomyces avermitilis ) as a host, a sedoheptulose-producing strain was produced, and the amount of sedoheptulose in the culture solution was studied.

[0131] 1-1. Disruption of transaldolase gene

[0132] 1-1-1. Disruption of the transaldolase gene of Streptomyces lividans

[0133] The transaldolase gene (SLI_2249) of Streptomyces lividans 1326 strain (NITE deposit number: NBRC15675) was destroyed by homologous recombination. The transformation of Streptomyces lividans was carried out according to a conventionally known method. Positions 1-1119 of SLI_2249 were disrupted, and gene disruption was confirmed using primers AAGATCCCGGTCTTCGAGGCGGGCAAGGGC (SEQ ID NO: 25) and GCGGCGTAGGTGTCGGTCTTCGACTTGGGG (SEQ ID NO: 26).

[0134] 1-1-2. Trehalose synthase gene disruption of Streptomyces lividans

[0135] The t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Sedoheptulose, which is a saccharide falling within the categories of ketoses and heptuloses, is one of a small number of heptuloses occurring in nature. The present invention addresses the problem ofproviding a method for producing sedoheptulose using a bacterium, a method for improving the productivity of sedoheptulose by the bacterium, and the bacterium. To solve this problem, provided are a method for producing sedoheptulose using a bacterium owing to the deletion or attenuation of a specific enzymatic function, a method for improving the productivity of sedoheptulose by the bacterium, and the bacterium.

Description

[0001] related application [0002] This application claims the benefit of priority to Application No. 2018-087503 filed with the Japan Patent Office on April 27, 2018. The entirety of the priority basic application constitutes a part of this specification by stating the source. technical field [0003] The present invention relates to methods of producing sedoheptulose using bacteria and methods of increasing the production of sedoheptulose based on bacteria and the bacteria. Background technique [0004] Sedoheptulose is a sugar classified as a seven-carbon sugar and a ketose, and is one of the few seven-carbon sugars that occur naturally. Sedoheptulose is a constituent sugar of D-sedoheptulose-7-phosphate in the pentose phosphate pathway of the biological metabolic system. As a preparation method of sedoheptulose, a bacterium-based method has been reported. So far, Streptomyces nara ( Streptomyces naraensis ) (patent documents 1-2 and non-patent document 1), Streptomy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P19/02C12N1/21C12N15/54
CPCC12P19/02C12N9/1022C12N9/90C12N9/93C12Y202/01002C12Y504/99016C12Y604/01003
Inventor 山本省吾
Owner NAGASE & COMPANY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com