Check patentability & draft patents in minutes with Patsnap Eureka AI!

Establishment method of animal model of scoliosis

An animal model, a technique for establishing methods, applied to other methods of inserting foreign genetic material, using microinjection, peptides, etc.

Active Publication Date: 2022-06-14
HUNAN NORMAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the embodiment of the present application is to provide a method for establishing a scoliosis animal model, to solve the lack of technology of the scoliosis animal model in the prior art question

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Establishment method of animal model of scoliosis
  • Establishment method of animal model of scoliosis
  • Establishment method of animal model of scoliosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0089] 1) Construction of CCDC57 gene knocking zebrafish

[0090] 1-1) Get the zebraon fish CCDC57 gene sequence (gene ID: 100318317) from the NCBI database (https: / / www.ncbi.nlm.nih.nih.gov / gene / 100318317);Target, according to the target design rules, select the 16-24bp sequence of the beginning of GG / GGG and the end of the NGG as the target.

[0091] 1-2) Design and synthesis to expand the primer of GDNA templates.By directly combined with growth fragment primers, the T7 promoter sequence, target sequence and GRNA scaffold of the transcript of the transcription are fused.EssenceSpecifically, as shown in SEQ ID NO.2 and SEQ ID NO.3, as:

[0092] Positive primer: TAATACGACTCTATAGGGGGGGGGGGGGGAAAGAGCGCGTTTTTAGAGAAGC (SEQ ID No. 2);

[0093] Reverse primers: AGCACCGACTCGGTGCCACT (SEQ ID No.3).

[0094] 1-3) Expansion and purification GDNA templates: Taking PMD18T-GRNA as a template, SEQ ID No.2 and SEQ IDNO.3 as a primer, use Kod-FX high-fidth enzymes (Phanta Super-Fidelity DNA Poly...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The embodiment of the present application provides a method for establishing an animal model of scoliosis, comprising the following steps: synthesizing gRNA and Cas9 mRNA based on the target gene, the target gene corresponding to the exon of the ccdc57 gene. The gRNA and Cas9 mRNA were loaded into zebrafish embryos to obtain F0 embryos; F0 embryos were bred to sexual maturity and mated with wild-type zebrafish to obtain F1 embryos, and effective mutant embryos were screened to obtain effective knock-outs of the same genotype after adulthood. In addition to zebrafish, the effective knockout zebrafish was self-crossed to obtain F2 embryos, which were cultivated to adulthood and screened to obtain ccdc57 homozygous knockout zebrafish. Since the water resistance on the spine of fish is similar to the gravity on the spine of humans walking upright, the animal model of scoliosis established by zebrafish is more suitable for excavating the pathogenic mechanism of scoliosis and exploring the treatment plan.

Description

Technical field [0001] This application involves the field of biomedical, and more specifically, it involves the establishment of spinal bending animal models. Background technique [0002] Scoliosis is divided into congenital spinal bending and special spina -side bending. Congenital spine bending (CS) is caused by abnormal vertebral development, which is more common in vertebral body development.Cause of semi -vertebral deformities is the main cause of congenital spine bending.Idiopathic scoliosis (IS) refers to the spine side curvature caused by no clear cause, which is the most common cause of human spine bending. It affects about 3 % of children in the world.EssenceTherefore, the treatment method is limited to the treatment of spine malformations by performed in vitro -assisted support or correction surgery.The special spine bending is common in adolescence and worsen with age. It has gender bias in the severity of the onset process. Women often have faster onset process and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/89A01K67/027
CPCC12N15/89A01K67/0276C07K14/461A01K2227/40A01K2267/03
Inventor 舒玉琴李璐黎娟郭子健杨聪慧许效玮汤玉洁贺佳欣贺伟
Owner HUNAN NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More