An r gene that controls soybean-rhizobia compatibility and its protein and application

A rhizobia and matching technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., to achieve the effect of improving the ability of symbiotic nitrogen fixation

Active Publication Date: 2022-07-01
HENAN UNIVERSITY +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention proposes an R gene for controlling soybean-rhizobia compatibility and its protein and its application, which solves the regulation of soybean-rhizobia compatibility and how to use the compatibility of soybean and rhizobia to improve soybean nitrogen fixation capacity, thereby improving Technical Problems of Soybean Utilization Efficiency of Nitrogen

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An r gene that controls soybean-rhizobia compatibility and its protein and application
  • An r gene that controls soybean-rhizobia compatibility and its protein and application
  • An r gene that controls soybean-rhizobia compatibility and its protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] In this application, the core germplasm of cultivated soybean is constructed. Through genome-wide association analysis, an R gene in soybean, GmNNL1, that can simultaneously affect the number of soybean nodules, nitrogenase activity per plant and above-ground biomass is identified. Through haplotype analysis, it was found that among the 6 main haplotypes of GmNNL1, only GmNNL1 HT1 (sequence shown in SEQ ID No. 2) can normally encode a complete typical R protein of TIR-NBS-LRR, and the other 5 haplotypes (sequences shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8) all resulted in incomplete protein forms due to the insertion of a transposon GmSINE1 or the deletion of a single base ( figure 1 ). Through haplotype analysis, it was found that GmNNL1 HT1 The number of nodules of haplotype soybean was significantly lower than that of other haplotypes ( figure 2 ), by comparing the structurally intact form of the R protein GmNNL1 HT1 and the inco...

Embodiment 2

[0032] The gene sequence of GmNNL1 was obtained using the following method:

[0033] The total volume of the reaction system was 50 μl, and the template was 1 μL (about 50 ng) of genomic DNA of soybean strain Hengfeng udon, 5 μl of 10×KOD enzyme reaction buffer, and 25 mM MgCL 2 2μl, 5mM dNTP 5μl, 5uM primer 5μl (primers NNL1-F and NNL1-R, each primer is 2.5μl), 1μl KOD enzyme, add ddH 2 O (sterile deionized water) to 50 μl. The reaction program was: denaturation at 94°C for 5 min, 94°C for 30 s, 55°C for 1 min, 68°C for 3.5 min for 35 cycles, and extension at 68°C for 10 min. The primers are: NNL1-F: ATGGCACACAGAACAGCACCATCT; NNL1-R: TCATTTAACAACATAGTACAAAC; finally a gene sequence containing the nucleotides described in SEQ ID NO.2 is obtained, and the protein encoded by the gene is shown in SEQ ID NO.3.

[0034] The protection content of the present invention also includes the nucleotide sequence corresponding to the amino acid sequence shown in SEQ ID NO. 3, and also in...

Embodiment 3

[0036] The application of GmNNL1 gene in regulating soybean-rhizobia compatibility and thus affecting the nitrogen fixation efficiency of soybean symbiosis. The application process is as follows:

[0037] The promoter and full-length CDS of GmNNL1 cloned from HFWD were cloned into pUB-GFP and transformed into Williams82 (WS82, GmNNL1 HT2 ), after inoculation with USDA110 in the obtained transgenic lines, GmNNL1 HT1 The higher the expression level, the less the number of nodules ( Image 6 ). Therefore, the nodulation of specific species of rhizobia can be reduced by this method. The specific process is:

[0038] (1) The GmNNL1 promoter region is obtained by the following methods:

[0039] The total volume of the reaction system is 50 μl, and the template is 1 μl (about 50 ng) of Hengfeng udon genomic DNA, 5 μl of 1×KOD enzyme reaction buffer, and 25 mM MgCL 2 2μl, 5μl of 5mM dNTP, 5μl of 5uM primer (2.5μl of primers pNNL1-F and pNNL1-R respectively), 1μl of KOD enzyme, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and relates to the application of new genes, in particular to an R gene for controlling soybean-rhizobia matching, and its protein and application. Gene disclosed in the present invention GmNNL1 in the soybean line Hengfeng black bean GmNNL1 The genome sequence is shown in SEQ ID NO.2, and the encoded amino acid sequence is shown in SEQ ID NO.3. soy R Gene GmNNL1 It is an effective gene that can regulate the number of nodules of specific rhizobia on soybean. It can regulate the number of nodules by directly recognizing the haplotype of the specific effector protein NopP of slow-growing rhizobia, limiting the symbiotic nodulation of indigenous rhizobia, The soybean is preferentially nodulated with the artificially applied high-efficiency rhizobia agent, and the symbiotic nitrogen fixation ability can be improved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the application of new genes, in particular to an R gene for controlling soybean-rhizobia compatibility, a protein thereof, and applications thereof. Background technique [0002] Cultivated soybean [Glycine max (L.) Merr] originated in my country and is an important food, feed, oil and energy crop in the world. It is one of the traditional "grains" and an important part of people's daily diet (Palander et al. , 2005). At the same time, with the pressure of my country's economic development and population surge on food demand, my country has used a large number of chemical fertilizers in food production, among which nitrogen fertilizer is the most common. According to the statistics of the World Food and Agriculture Organization (FAO), my country's annual nitrogen fertilizer use continued to rise from 2002 to 2014; although my country's cultivated land area only accounts for 8% of the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/11C12N15/84C12N15/113A01H6/54A01H5/06C12Q1/6895
CPCC07K14/415C12N15/8261C12N15/8227C12Q1/6895C12Q2600/158C12Q2600/13
Inventor王学路张豹李友国
OwnerHENAN UNIVERSITY