Supercharge Your Innovation With Domain-Expert AI Agents!

A nucleic acid molecular primer, method and kit for identifying Lactobacillus gluecap

A nucleic acid molecule, dairy cow technology, applied in microorganism-based methods, biochemical equipment and methods, microorganisms, etc., to achieve the effect of simple method and good specificity

Active Publication Date: 2022-03-18
JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report on molecular identification methods related to S.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A nucleic acid molecular primer, method and kit for identifying Lactobacillus gluecap
  • A nucleic acid molecular primer, method and kit for identifying Lactobacillus gluecap
  • A nucleic acid molecular primer, method and kit for identifying Lactobacillus gluecap

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Acquisition and Genomic DNA Extraction of Lactobacillus mucilaginus

[0036] 1. From Mopanshan National Forest Park (101.96 ° E, 23.95 ° N) in Xinping Yi Autonomous County, Yunnan Province, the fruiting body of Boletus mucilaginous caps that has grown vigorously and has not been opened (see figure 1 ), put it in the ice box and take it back to the laboratory on the same day, and immediately separate it in the ultra-clean workbench to obtain the tissue block for culture, the tissue block is 5×5mm.

[0037] 2. The cut tissue pieces are inoculated into plate medium, and the medium components are: potato dextrose agar (PDA) dry powder (40g / L), malt extract powder (10g / L), vitamin B1 (50mg / L ), complex vitamin B tablets (1 tablet / L, each tablet contains vitamin B1 3mg, vitamin B2 1.5mg, vitamin B6 0.2mg, niacinamide 10mg, calcium pantothenate 1mg), potassium myristate (0.5-1mmol / L) .

[0038] 3. Inoculate 10 plate repeats, place them in a constant temperature in...

Embodiment 2

[0042] Embodiment 2: the PCR amplification of the milk boletus specific primer of sticky cover

[0043]Design specific nucleic acid molecular primers C50F and C50R according to the Lactobacillus colicap Peptidase family C50 gene family gene (Gene ID 12967), C50F: 5'-CTGTCGCAGATAGATGTAGA-3' (SEQ ID NO.2) and C50R: 5'-CTTGAGGAGCCAGAGTGT -3' (SEQ ID NO.3), the primer was synthesized by Shanghai Biological Engineering Co., Ltd. The total volume of the PCR amplification reaction system is 50 μL: DNA template 1 μL, Taq DNA polymerase (5U / μL) 1 μL, upstream primer C50F (10 μmol / L) 1 μL, downstream primer C50R (10 μmol / L) 1 μL, 10×Buffer 5 μL, 2mmol / L dNTP 5μL, 25mmol / L MgCl 2 3 μL, make up ddH 2 0 to 50 μL. The DNA templates are the fruiting bodies and hyphae DNAs finally obtained in Example 1, respectively. The reaction program was: pre-denaturation at 94°C for 4 minutes; 35 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 60 s; the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid molecular primer, a method and a kit for identifying milk boletus gluconosa. The DNA sequence of the nucleic acid molecule primer is: C50F: CTGTCGCAGATATAGATGTAGA; C50R: CTTGAGGAGCCAGAGTGT. The method for discriminating the boletus colibri comprises the following steps: S1 extracts the sample DNA of the boletus colibri to be tested; S2 uses the sample DNA as a template for PCR amplification, and performs PCR amplification with nucleic acid molecule primers C50F and C50R as amplification primers ; S3 carries out agarose gel electrophoresis detection on the PCR amplification product of step S2. The nucleic acid molecular primer of the invention can carry out rapid molecular identification on the fruiting bodies and strains of the milk boletus gluconosa, has good specificity, and at the same time requires less material, only 20 mg, and the method is simple, and the test can be completed in 2 hours.

Description

technical field [0001] The invention relates to the technical field of detection of edible fungi by molecular biology methods, in particular to a nucleic acid molecular primer, a method and a kit for identifying Suillus bovinus. Background technique [0002] The genus Suillus belongs to Fungi, Basidiomycota, Agaricomycetes, Boletales, and Suillaceae. Mycorrhizal fungi can form a symbiotic relationship with a variety of trees, especially coniferous species. There are 509 records of boletus species in Index Fungorum (http: / / www.indexfungorum.org). In the genus Boletus, most species are edible except for a few species that are poisonous or bitter and cannot be eaten. Suillus bovinus is mainly distributed in coniferous forests. It is a very rare edible fungus. It is widely used in cooking in Yunnan, Guangdong, Guangxi and other regions. It is rich in various proteins, vitamins and antioxidant active substances. The content of carbohydrates and fats is very low, and it is a ve...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/686C12Q1/04C12N15/11C12R1/645
CPCC12Q1/6895C12Q1/686C12Q2565/125
Inventor 陈佳佳刘国华宋杰于健陈义彬杨广荣
Owner JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More