Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A specific ss-coi primer pair, identification kit and rapid identification method for the coffee berry bark beetle

A technology of coffee cherries and primer pairs, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of difficult identification, complex process, heavy workload, etc. , high sensitivity and simple method

Active Publication Date: 2021-08-24
SPICE & BEVERAGE RES INST CHINESE ACAD OF TROPICAL AGRI SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Traditionally, the species identification of the coffee berry beetle mainly relies on external morphological characteristics. Since closely related species often appear in the same habitat, insect taxonomy professionals and microscopic equipment are needed to identify them. There are problems such as difficulty in identification and time-consuming. It is not conducive to mastering the dynamics of the insect's invasion and spread; and for samples such as eggs, larvae, pupae, and characteristic shedding residues, it cannot be identified by morphological characteristics
Therefore, in the process of quarantine and monitoring, traditional morphological identification methods can no longer meet the actual work needs
[0005] In recent years, with the development and wide application of molecular biology techniques, the molecular identification technology based on mitochondrial DNA cytochrome c oxidase subunit I (mtDNA COI) markers has been used for the identification of various insect species, but this method requires PCR products are subjected to base sequence sequencing and phylogenetic analysis, which is time-consuming, money-consuming, and heavy workload
In addition, technologies such as restriction fragment length polymorphism (RFLP) and single-strand conformation polymorphism (SSCP) are also commonly used in the identification of insect species, but the process is complicated and requires enzyme digestion, PCR, and polyacrylamide gel electrophoresis. , silver staining and other steps, there are also problems such as time-consuming and laborious
Therefore, in order to solve the problem that the coffee berry beetle lacks rapid identification technology at present, it is necessary to provide a coffee berry beetle-specific SS-COI primer and a rapid molecular identification method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A specific ss-coi primer pair, identification kit and rapid identification method for the coffee berry bark beetle
  • A specific ss-coi primer pair, identification kit and rapid identification method for the coffee berry bark beetle
  • A specific ss-coi primer pair, identification kit and rapid identification method for the coffee berry bark beetle

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1: Extraction of insect genome DNA

[0047] Genomic DNA was extracted using the Ezup Column Animal Genomic DNA Extraction Kit from Sangon Bioengineering Co., Ltd. The specific operation steps are as follows:

[0048] (1) Clean the single-headed beetle with absolute ethanol for 5 seconds, then wash it with sterile water for 5 times, and place it on a sterilized filter paper to dry;

[0049] (2) Put the dried beetle into a 1.5mL centrifuge tube, add 180μL BufferACL, grind the sample thoroughly with an electric grinder, then add 20μL Proteinnase K solution, shake and mix well, and bathe in 56℃ for 1 hour until the cells are completely lysed ;

[0050] (3) Add 200μL Buffer CL and mix thoroughly by inversion;

[0051] (4) Add 200 μL of absolute ethanol and mix thoroughly by inversion;

[0052] (5) Put the adsorption column into the collection tube, add all the solution and translucent fibrous suspension into the adsorption column with a pipette, let it stand for 2...

Embodiment 2

[0056] Embodiment 2: PCR amplification of bark beetle insect COI gene

[0057] According to the report of Jordal et al. (2011), S1718 / A2237 was selected as the universal primer for bark beetle COI gene amplification:

[0058] S1718: 5'-GGAGGATTTGGAAATTGATTAGTTCC-3'

[0059] A2237: 5'-CCGAATGCTTCTTTTTTTACCTCTTTCTTG-3'

[0060] Use Tiangen 2×Taq PCR MasterMix II kit for PCR amplification reaction, the total reaction system is 25 μL, including:

[0061]

[0062] Amplification conditions: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 46°C for 50 s, extension at 72°C for 1 min, 40 cycles; extension at 72°C for 10 min.

[0063] Take 5 μL of the PCR product, and separate it by electrophoresis on a 1.2% agarose gel containing Gel stain staining agent for 20 min (140V), detect the result with a gel imaging system, and take pictures.

[0064] The results showed that the COI gene fragments of 13 bark beetle insects including the coffee berry beetle...

Embodiment 3

[0065] Example 3: Design of specific primers for the coffee berry beetle COI gene

[0066] The COI sequences of 13 bark beetle insects obtained in this study (including coffee berry bark beetle) were verified by Blast sequence alignment in NCBI. The results showed that the COI fragments of 13 bark beetle insects were successfully amplified using the universal primer S1718 / A2237. The 13 COIs were then subjected to multiple sequence alignment analysis, and a pair of COI-specific primers (SEQ ID NO: 1, SEQ ID NO: 2) for the coffee berry beetle were designed using the PrimerSelect software in DNASTAR:

[0067] HHTYF1: AAGGTGTTGATATAGGATTGGGTCC

[0068] HHTYR3: CCACTAATACTAGGCGCACCTG

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnology, in particular to a specific SS-COI primer pair, identification kit and rapid identification method of the coffee berry beetle. The specific SS-COI primer pair consists of an upstream primer shown in SEQ ID NO:1 and a downstream primer shown in SEQ ID NO:2. The specific SS-COI primer and method of the invention realize the rapid molecular identification of the coffee berry beetle, the method is simple, easy to operate, short in time consumption, wide in the identification range and high in sensitivity.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a pair of specific SS-COI primers, an identification kit and a rapid identification method for the coffee berry beetle. Background technique [0002] The coffee berry beetle Hypothenemus hampei Ferrari, belonging to Coleoptera, Scolytidae, and Hypothenemus Westwood, is the number one pest of the coffee industry in the world. List of Imported Phytosanitary Pests". The female adult begins to bore at the end of the fruit, gnaws inwards to form irregular tunnels, reaches the endosperm and lays eggs, and does not fly out of the fruit throughout the period, and stays with the offspring for life; after hatching, the larvae feed on the pulp and seed endosperm , after it emerges as an adult, it can inbreed and reproduce among siblings, and then the female adult flies out of the tunnel to find new fruits to drill and lay eggs. In addition, in addition to damaging coffee, the worm also has ot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888
Inventor 王政孟倩倩孙世伟刘爱勤苟亚峰高圣风
Owner SPICE & BEVERAGE RES INST CHINESE ACAD OF TROPICAL AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More