Specific primer pair for identifying beet coracoid and application of specific primer pair

A primer pair, sugar beet technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of non-specific PCR products, difficult molecular identification, unstable results, etc. Relevant knowledge requirements, easy to carry out widely, easy to operate

Pending Publication Date: 2022-05-13
吕梁市农业农村局 +2
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this technology also has disadvantages such as non-specific PCR products, unstable results, and poor repeatability, which brings certain difficulties to molecular identification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer pair for identifying beet coracoid and application of specific primer pair
  • Specific primer pair for identifying beet coracoid and application of specific primer pair

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 sample DNA extraction

[0020] Genomic DNA extraction of sugar beet beetle weevil and other field pests adopts the kit method, and the kit used is Ezup Column Animal Genomic DNA Extraction Kit; purchased from Sangon Bioengineering Co., Ltd. The specific operation steps are as follows:

[0021] (1) Soak the preserved insect samples in absolute ethanol, separate the single-headed insects (eggs, pupae), wash them twice with sterile water, and place them in sterile water for 24 hours to completely remove the ethanol residue. Afterwards, the worms were placed on sterilized filter paper to dry;

[0022] (2) Put the dried sample into a new 1.5mL sterilized centrifuge tube, add digestion solution and grind the sample fully with an electric grinder, then perform DNA extraction according to the DNAEzup column animal genome extraction kit operation manual;

[0023] (3) When the sample DNA is on the adsorption column in the last step, add 50 μL of sterilized deionized w...

Embodiment 2

[0025] Embodiment 2: the RAPD amplification of sample DNA

[0026] According to the principle of RAPD, 20 primers of RAPD 10-mer Set B, a random primer set from BGI, were selected for PCR screening of DNA samples of beet beetle weevil and other field pests.

[0027] Use Tiangen 2×Taq PCR MasterMix II reagent for PCR amplification reaction. The total reaction system is 25 μL, including: 1 μL of sample DNA to be tested; 1 μL of random primers; 12.5 μL of 2×Taq PCR MasterMix II; 10.5 μL of sterile water. The DNA concentration of the sample to be tested is not less than 250pg / μL; the molar concentration of the random primer is 10μM. The PCR program was: 95°C for 3min; 95°C for 30s, 40°C for 45s; 72°C for 1min, a total of 35 cycles; 72°C for 2min, and 4°C to store the PCR product. 3 μL of the PCR product was used for agarose gel electrophoresis to detect the amplification result. The agarose gel was 1.0%, the voltage used was 180V, and a gel imaging system was used to take pictur...

Embodiment 3

[0028] Example 3: Design and identification of specific primers for the sugar beet beetle beak

[0029] The PCR product was sequenced to obtain a definite base sequence of 428bp. After analyzing the sequence, use Primer Premier5 software to design specific primers. Upstream primer sequence: SEQ ID NO: 1: TGTCGTGAAGTCAACTACTGATG, downstream primer sequence: SEQ ID NO. 2: CGCTACTCACGATGATCTCTGATC. The primers were sent to Sangon Bioengineering Co., Ltd. for synthesis. The predicted fragment size of the PCR product of the pair of primers is 223bp.

[0030] Amplification and identification of DNA samples from different developmental stages of beet beetle weevil (eggs, early larvae, mature larvae, pupae, female adults and male adults) and DNA from other field pests were carried out. Use Tiangen 2×Taq PCR MasterMix II reagent for PCR amplification reaction, the total reaction system is 25 μL, including: 1 μL of sample DNA to be tested; 0.5 μL of upstream primers; 0.5 μL of downst...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a molecular identification method for detecting beet coracoid by using a specific PCR (Polymerase Chain Reaction) primer. According to the method, an RAPD (Random Amplified Polymorphic DNA) technology is utilized to obtain a specific sequence of the coracocystis beet, an efficient PCR (Polymerase Chain Reaction) amplification primer is designed, a PCR detection system complementary to the efficient PCR amplification primer is established, and a specific 223bp single DNA band of the coracocystis beet is rapidly obtained. The method has the advantages of being convenient to operate, accurate in identification and the like, rapid molecular identification of the beet coracoid can be achieved, and the reaction speed of pest detection and targeted prevention and control is increased.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a specific primer for the beet tuber beetle elephant and a rapid identification method thereof. Background technique [0002] Lixus subtilis Boheman belongs to the family Coleoptera, also known as the beet stem weevil. It mainly damages sugar beets in my country, and can also damage some wild weeds of Chenopodiaceae, Polygonaceae, and Amaranthaceae. Quinoa Chenopodium quinoaWilld, Chenopodium quinoa, is native to the Andes in South America. Because it is rich in minerals, vitamins, fatty acids, etc., it can reduce the risk of suffering from various diseases. It is listed as one of the top 10 healthy and nutritious foods in the world, and has extremely high economic value. In recent years, quinoa has been widely introduced and planted in my country and has become a pillar product in local counties and cities. With the widespread development of quinoa planting, beet tube beak weevil ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6888C12Q1/6858C12N15/11
CPCC12Q1/6888C12Q1/6858C12Q2600/156C12Q2531/113C12Q2535/139C12Q2565/125
Inventor高晓勋刘一景孙凌贾彦生
Owner吕梁市农业农村局