Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

84 results about "Boletales" patented technology

The Boletales are an order of Agaricomycetes containing over 1300 species with a diverse array of fruiting body types. The boletes are the best known members of this group, and until recently, the Boletales were thought to only contain boletes. The Boletales are now known to contain distinct groups of agarics, gasteromycetes, and other fruiting-body types.

Bolete extracting solution and beverages as well as preparation methods thereof

The invention discloses bolete extracting solution and beverages, belonging to the field of edible fungi beverages. The preparation method of the bolete extracting solution comprises the following steps of: extracting crushed bolete dry powder or fresh bolete slurry in water, then filtering to obtain filtrate, centrifuging the filtrate, and collecting supernate. By utilizing the bolete extracting solution, different flavors of bolete beverages can be prepared. The bolete beverage has rich nutrient components and simultaneously contains a great deal of polysaccharides with the functions of improving body immunity, reducing the blood sugar levels and cholesterol, resisting the ageing, and the like; secondly, the invention is convenient to carry and ready to drink and solves the problem that fresh bolete is difficult to store and transport; the invention can be also used as raw materials of beverages and food processing and prepared into different flavors of beverages; and besides, the invention has simple method, low cost and no environmental pollution.
Owner:CHUXIONG HONGGUI GREEN FOOD

Semi-artificial culture method of phlebopus portentosus

ActiveCN101669430ASimple methodSimplify the cultivation processHorticultureFertilizer mixturesYoung treePhlebopus portentosus
The invention relates to a semi-artificial culture method of phlebopus portentosus. The method includes the following steps: firstly, culturing delonix regia, artocarpus heterophyllus lam seedling andgrapefruit grafted seedling; then transplanting the delonix regia, the artocarpus heterophyllus lam seedlings and the grapefruit grafted seedlings to a field; and when age of the tree reaches 1 year,inoculating the solid strain of phlebopus portentosus on the root systems of the delonix regia, an artocarpus heterophyllus lam treelet and a young or mature grapefruit. After one year of the inoculation, the fruiting bodies of phlebopus portentosus grow under the delonix regia, the artocarpus heterophyllus lam tree and the grapefruit tree and develop mature, and more than 10-80kg of phlebopus portentosus can be produced per 100m<2>. The use of the method can rapidly realize the semi-artificial culture of phlebopus portentosus, as well as industrialization. The semi-artificial culture methodof phlebopus portentosus is simple, saves the process of artificially synthesizing the root source of bacteria, is short in fruiting time, simultaneously harvests economical crop fruits and the fruiting body of boletus, realizes the common harvest of fruits and bacteria, greatly increases output, saves capitals and other corresponding growing cost and improves land use capability.
Owner:YUNNAN INST OF TROPICAL CROPS

Shanzhen series of dried noodle

The invention discloses a shanzhen series of dried noodle, relating to a noodle matched with shanzhen series of medicinal materials and aiming at solving the problem that the nutrient component of the existing dried noodle is single. The invention provides a shanzhen series of dried noodle which is prepared by the following materials with weight proportion: 2 percent to 6 percent of mushroom powder, 2 percent to 3 percent of tricholoma matsutake powder, 2 percent to 3 percent of Chinese toon powder, 2 percent to 3 percent of boletus powder, 2 percent to 3 percent of termitomyces powder, 56.4 percent to 78 percent of wheat flour, 10 percent to 25 percent of wheat germ powder and 0.1 percent to 0.6 percent of sodium carbonate; the invention also provides a preparing technique of the dried noodle, comprising the following steps of: taking the above materials, stirring the materials evenly, adding water, kneading the flour, curing, delivering laminating pieces, strip cutting, drying, cooling and sterilizing. The shanzhen series of dried noodle remains the beneficial components of various shanzhen materials, can improve immune function and strengthen the body.
Owner:刘贵有

Establishing method of symbiont of cyclobalanopsis glaucoides and bolete

The invention relates to an establishing method of symbiont of cyclobalanopsis glaucoides and bolete, belonging to the field of biotechnology (plant tissues and fungal culture). In the research of mycorrhizal fungi, a stable pure symbiont of plants and fungus is difficult to establish. At present, bolete can not be cultivated artificially easily, belongs to mycorrhizal fungi capable of realizing mutualistic symbiosis with the plant, and has symbiotic relationship with pinaceae plants, fagaceae plants and the like under natural condition. According to the establishing method, cyclobalanopsis glaucoides seed and generalized delicious beef liver mushroom entity collected in the Wuding lion rock are used as materials, so that callus and mycelium are respectively induced successfully and are cultured together in an innovation manner, and a simple and stable pure-symbiont system is established under the sterile state. Important basis is provided for the symbiotic relationship and the symbiotic mechanism of bolete, cyclobalanopsis glaucoides and the other plants and the molecular mechanism of the beef liver mushroom entity and the like, and the method use for reference is provided for research on other macro fungi and symbiotic plants.
Owner:YUNNAN UNIV

Bolete soft sweet containing fine proteins

The invention discloses bolete soft sweet containing fine proteins. The bolete soft sweet consists of the following raw materials in parts by weight: 220-230 parts of maltose, 100-110 parts of cane sugar, 45-50 parts of starch syrup, 3-4 parts of agar, 8-9 parts of edible gelatin, 20-30 parts of bolete, 30-40 parts of brown rice, 20-30 parts of milk powder, 12-15 parts of gadus protein powder, 5-6 parts of Japanese ampelopsis root, 4-5 parts of angelica dahurica, 4-5 parts of Mongolian snakegourd root, 5-6 parts of platycodon root and 4-5 parts of fragrant solomonseal rhizome. In the bolete soft sweet containing the fine proteins disclosed by the invention, the milk powder and the gadus protein powder are added, so that fine proteins essential for human bodies can be provided, and rich nutrition is supplied; moreover, extracts of Chinese medicinal materials such as the Japanese ampelopsis root, the Mongolian snakegourd root and the like are added, so that the bolete soft sweet can clear away heat and toxic materials, dissipate heat, resist cancers, promote the secretion of saliva or body fluid, quench thirst and the like, and has a certain health care function.
Owner:WUHE TONGSHIFU FOOD

Chinese chestnut wine and preparation method thereof Chinese chestnut fungus root preparations and preparation method thereof

The present invention discloses one kind of Chinese chestnut mycorrhiza preparation obtained with Rhizopogon and Boletus edulis and through simultaneous culturing. The Chinese chestnut mycorrhiza preparation can raise the fertilizer and water absorbing ability of Chinese chestnut root system, expand the absorption area, decompose soil nutrients, strengthen drought fighting capacity, and secrete hormone and organic acid to enhance physiological activity of root system.
Owner:秦岭

Bolete meat-flavored powder and preparation method thereof

The invention relates to bolete meat-flavored powder and a preparation method thereof. The preparation method comprises the following steps: enabling fresh bolete and complex enzyme to perform enzymolysis; performing a Maillard reaction; jointly grinding an embedding agent and products obtained from the Maillard reaction of the bolete into thick liquid, and performing spray drying and superfine pulverization so as to obtain the bolete meat-flavored powder. The bolete meat-flavored powder is strong in meat flavor, is unique in fragrance, and is delicate in flavor; besides, the unique fragrance and nutritional ingredients of bolete are retained, so that the bolete meat-flavored powder can be used as a flavor enhancing agent during cooking and cooking soup, and also can be used as barbecue seasoning; the bolete meat-flavored powder can provide vegetable with meat flavor, and can be used as a seasoning for puffed foods, such as potato chips. The bolete meat-flavored powder is an ideal flavor seasoning and an ideal food additive.
Owner:KUNMING UNIV OF SCI & TECH

Ectomycorrhiza-enriched container seedling and cultivation method thereof

The invention discloses a container seedling rich in mycorrhiza which takes lightweight mixed materials with strong water absorption such as sterilized peat soil and biochar as a substrate, a seedlinggrowing container with the functions of air rot cutting and the like as a carrier, pure mycelia or spores of cultured ectomycorrhiza such as L.lividatus Berkeley and M.A.Curtis, russula heterophyllaFr., boletus edulis Bull.:Fr., tuber aestivum Vittad, tuber melanosporum Vittad and thelephora ganbajun Zang as an inoculant, seeds or seedlings of pinaceae plants such as pinus massoniana Lamb., pinus yunnanensis Franch and pinus elliottii Ehgelm, corylaceae plants such as corylus heterophylla Fisch .ex Trautv .var .sutchuenensis Franch. and corylus heterophyllaxavellanas, seeds or seedlings of fagaceae plants such as cyclobalanopsis gilva(Blume)Oerst, quercus acutissima Carruth., castanea mollisima, quercus aquifolioides Rehd and quercus franchetii Skan, and seeds or seedlings of tiliaceae plants such as Hunan tilia tuan Szyszyl. and craigia yunnanensis as a host plant, and is cultivated under suitable temperature, humidity and light conditions and a method for cultivating the mycorrhizacontainer seedling. Mycorrhizal seedlings cultivated by the method have the advantages of large quantity of mycorrhiza, good quality, high afforestation survival rate and rapid growth recovery, and mycorrhizal edible fungus fruiting bodies produced by the method are high in yield.
Owner:HUNAN ACAD OF FORESTRY

Production increasing method for bolete in forests

The invention relates to a production increasing method for mycorrhizal edible fungi in forests, which comprises the steps of: eliminating non-target host plants and mycorrhiza of non-target mycorrhizal fungi in a forest on the premise of identifying and positioning bolete host plants and mycorrhiza distribution area in a traditional artificial forest or a natural forest, and supplementing mycorrhiza seedlings inoculated with the bolete. The updated treatment technology is beneficial to faster enlarging fungal distribution ranges and fungal dominance degree in the traditional forest land producing the bolete so as to connect bolete ponds in the forest into a whole, thereby further greatly improving the yield of the bolete.
Owner:HUNAN ACAD OF FORESTRY

Preservation method of boletus bainiugan dentinger

The invention discloses a preservation method of boletus bainiugan dentinger. The preservation method comprises the following steps: firstly precooling the boletus bainiugan dentinger in a refrigeration house at 2-6 DEG C, sealing after being placed in a gas-adjusted fresh-preserved storehouse, and then cold-storing in the refrigeration house at 2-6 DEG C, wherein the concentration of nitrogen in the gas-adjusted fresh-preserved storehouse is 80-96%, the oxygen concentration is 2-10% and the carbon dioxide concentration is 2-10%. The storage period of the boletus bainiugan dentinger treated by using the method disclosed by the invention is prolonged by 6-9 days in comparison with the boletus bainiugan dentinger which is stored at 2-4 DEG C without the preservation treatment, and is prolonged by 10-15 days in comparison with the boletus bainiugan dentinger which is stored at 10-16 DEG C without the preservation treatment; and meanwhile, the conditions such as worm damage, rotting and lesion of the boletus bainiugan dentinger treated through the method disclosed by the invention can be obviously improved in the storage period, and the sensory quality such as the appearance, the flavor and the like can be well maintained.
Owner:云南省农业科学院生物技术与种质资源研究所

Culture method for inhibiting browning of bolete mycelium

The invention relates to a culture method for inhibiting the browning of bolete mycelium and belongs to the technical field of organism (macro fungi culture). The artificial culture of bolete is difficult to realize at present, and bolete fruiting bodies completely rely on wild picking. In recent years, because of the reasons of climate change, ecological damage and the like, the natural yield isseriously reduced, and the price is high. The growth of bolete hyphae on an artificial culture medium is slow, the culture medium and the hyphae easily brown after the hyphae grow for a period of time, and the subsequent growth is influenced. According to the method provided by the invention, a strain of unopened boletus edulis fruiting body produced in Yunnan is adopted as materials, paths such as mycelium inducing, mycelium activation and the like are adopted, and a culture medium capable of inhabiting or reducing the browning is provided. The culture medium has the characteristics that ingredients are clear and simple, the cost is low, the growth of the mycelium is fast, the bacterial colony is white and clean, and the like. Important foundation is laid for the scaled culture, artificial or semi-artificial domestication and the like of the bolete mycelium.
Owner:YUNNAN UNIV

Flax liver calming bolete sundry fungus soup base and preparation method thereof

The invention discloses a flax liver calming bolete sundry fungus soup base and a preparation method thereof. The flax liver calming bolete sundry fungus soup base is characterized by being prepared by the following raw materials including, by weight, flax, platycladi seeds, oroxylum indicum, hematoxylon, calamus, solanum lyratum thumb roots, roots of privet-like premna, gerbera, bolete, black fungus, grifron maitake, garlic, green onion, fresh ginger, cassava starch, salt, oat powder and anise; the soup base is prepared by the working procedures including cleaning, raw material processing, mixing, decontamination and sterilization bagging. The flax liver calming bolete sundry fungus soup base has the advantages that the taste is delicious, the storage is convenient, the liver calming effect is achieved, in addition, the preparation technology is more simple and hygeian.
Owner:HARBIN HAOTUO BIOLOGICAL SCI & TECH DEV

Artificially domesticated phlcbopus portentosus strain HZ18006 and SSR marker fingerprint thereof

The invention discloses an artificially domesticated phlcbopus portentosus strain HZ18006 and a SSR marker fingerprint thereof. The strain has the ability to significantly increase the yield of fruiting bodies, is deposited in the China General Microbiological Culture Collection Center (CGMCC) on March 18, 2019 with the preservation number of CGMCC No.17080. The laboratory and production practiceconfirm that the strain has high strain vigor and stable genetic characteristics, the fruiting speed is high and the fruiting is tidy in the late stage, the growth speed is high, the needs of large-scale factory cultivation are met, harvesting can be completed at one time in a best harvesting period, and the harvesting process is greatly simplified and labor is saved; and excellent biological growth characteristics such as simple fruiting body cultivation method, extensive management, high fruiting and high yield are further achieved. The SSR marker fingerprint of the HZ18006 strain is composed of 10 pairs of SSR markers, and is combined with an accurate quantitative capillary electrophoresis fluorescence detection method for rapid identification of the HZ18006 strain.
Owner:JINGHONG HONGZHEN AGRI TECH CO LTD

Edible mushroom compound nutritional salt and preparation method thereof

The invention belongs to the field of food seasonings and discloses edible mushroom compound nutritional salt and a preparation method thereof. The edible mushroom compound nutritional salt is composed of, by mass percentage, 60-90% of edible salt and 10-40% of edible mushroom powder, wherein edible mushrooms include tricholoma matsutake, sparassis crispa, bolete, collybia albuminosa and red mushrooms. Wild edible mushroom plant organs and edible salt are selected as the raw materials, extraction processing and ultrafine powder processing techniques and technology are adopted to extract effective active ingredients such as amino acids, polysaccharides, mineral elements, flavones, sterols and adenosine in the edible mushrooms, the extracted effective active ingredients are combined with theedible salt, and synthetic essence and perfume and the like are not added, so that the prepared nutritional salt can improve human immunity and resist tumor and radiation and is natural, healthful, green and functional.
Owner:云南省盐业有限公司

Digestion promoting carassius auratus feed and preparation method thereof

The present invention discloses a digestion promoting carassius auratus feed, which is prepared from the following raw materials, by weight, 120 to 130 parts of millet powder, 50 to 60 parts of wheat bran, 30 to 40 parts of flour, 30 to 40 parts of potato powder, 5 to 6 parts of date powder, 6 to 9 parts of hawthorn powder, 10 to 12 parts of brown sugar, 6 to 7 parts of corn flavor water, 2 to 4 parts of boletus, 3 to 4 parts of beta vulgaris seeds, 4 to 5 parts of green bean vine, 5 to 6 parts of vicia faba skin, 3 to 4 parts of russula nigricans, 1 to 2 parts of magnolia seeds, 1 to 2 parts of myrcia, 3 to 4 parts of mentha haplocalyx, 5 to 6 parts of an auxiliary agent, and a proper amount of water. The digestion promoting carassius auratus feed is low in cost and convenient to process, store and feed. The digestion promoting carassius auratus feed is rich in various proteins, trace elements and other nutrients. The digestion promoting carassius auratus feed has palatability and rich nutrients, and promotes the growth. The added hawthorn powder, magnolia seeds, myrcia and the like have the effects of digestion promoting and stomach invigorating so that the food intake of carassius auratus is increased and the health growth of the carassius auratus is promoted after the carassius auratus eats the feed.
Owner:范治淮

Solid ectomycorrhizal agent and preparation method and application thereof

The invention discloses a solid ectomycorrhizal agent and a preparation method and application thereof. The disclosed solid ectomycorrhizal agent includes bolete hypha, vermiculite and an MMN liquid culture medium. The solid ectomycorrhizal agent improves the transplanting survival rate of pinus sylvestris nursery stocks, the growth of the nursery stocks is promoted after transplanting, and the agent plays an important role in ecological restoration of a mining area and land reclamation of the mining area.
Owner:CHINA SHENHUA ENERGY CO LTD +2

Method for identifying and detecting boletus bainiugan dentinger or components of boletus bainiugan dentinger

PendingCN110734997AOvercoming technical shortcomings that cannot be detected using mass spectrometryLower quality requirementsMicrobiological testing/measurementMicroorganism based processesGeneticsMass Spectrometry-Mass Spectrometry
The invention relates to a method for identifying and detecting boletus bainiugan dentinger or componentsof the boletus bainiugan dentinger. Primers used in the detection method comprise: an upstreamprimer (F) 5'-GGATCATTATCGAGTTAGAC-3', and a downstream primer (R) 5'-TGGACATGCAATAGAGTA-3'. The method has the beneficial effects that 1) due to adoption of a fluorescent PCR (polymerase chain reaction) detection method, the technical defect that some items cannot be detected by mass spectrometry during custom clearance can be overcome; 2) the technical method provided by the invention has a significant advantage of short detection time; 3) the method has very low requirements on masses and concentrations of detected items, and thus goods, commodities or items barely have amount loss; 4) identification results obtained by using the primers and probes provided by the invention are very accurate, the blank of identification of delicious porcini and components of products of the delicious porcini in China can be made up, and although the invention only provides the method for identifying the boletus bainiugan dentinger, scientific research precedent of fluorescent PCR identification methods of other delicious porcini can be developed on the basis; and 5) the invention can provide necessary technical support for Chinese customs to perform relevant tasks.
Owner:昆明海关技术中心

Edible fungus noodle and preparation method thereof

The invention discloses an edible fungus noodle, which is composed of the following raw materials in parts by weight: 80 to 90 parts of barley, 45 to 55 parts of vigna eylindrica, 25 to 35 parts of seed of Job's tears, 10 to 15 parts of pumpkin flower, 20 to 25 parts of bolete, 20 to 25 parts of pleurotus nebrodensis, 18 to 24 parts of pholiota nameko, 1 to 2 parts of white glorybower, 1 to 3 parts of hawthorn, 1 to 2 parts of viola inconspicua, 1 to 2 parts of hollyhock root, 1 to 2 parts of noodle additive, and a proper amount of water. The preparation method takes barley, vigna eylindrica, and seed of Job's tears as the main raw materials; wherein the barley has the functions of treating diabetes, removing heat toxin, tonifying qi and the middle, relieving the fatigue, strengthening the blood vessel, moistening the skin, and relieving the hunger; the vigna eylindrica contains following components: protein, fat, sugar, phosphor, calcium, iron, zinc, vitamin B1, vitamin B2, nicotinic acid, pantothenic acid, stigmasterol, phosphatide, cyanophoric glycoside, blood coagulation factor, and the like; the bolete has the functions of fortifying the spleen, removing the dampness, clearing the heat, relieving the temper, nourishing the blood, regulating the middle, expelling the wind and cold, relaxing the muscles, activating the blood, tonifying deficiency, and refreshing; and the pleurotus nebrodensis has the functions of removing food retention, killing parasites, relieving cough, modulating the human physiological balance, and strengthening the human immunity.
Owner:田世伟

Specific primers for identifying Chiua virens and method for identifying Chiua virens by the specific primers

The invention discloses specific primers for identifying Chiua virens and a method for identifying Chiua virens by the specific primers. The specific primers for identifying Chiua virens are CVf and CVr. A DNA sequence of CVf is CTTACCGAACGGAMGGGATAACACC and a DNA sequence of CVr is AGAAGCAAAGNACAGGAAAAGCATA. The method for identifying Chiua virens by the specific primers comprises the following steps of extracting a total DNA of a mixed bolete sample, carrying out specific primer PCR amplification, and carrying out agarose gel electrophoresis detection of amplification products to identify if the mixed bolete sample is mixed with toxic and unclean Chiua virens. The method for identifying Chiua virens by the specific primers does not need a PCR product sequencing process and can realize rapid and accurate identification, wherein generally, time from mixed bolete sample taking to identification result production is in a range of 2 to 3 hours.
Owner:云南省农业科学院生物技术与种质资源研究所

Feed for pigs in layered raising and preparation method thereof

The invention discloses feed for pigs in layered raising and a preparation method of the feed for the pigs in the layered raising. The feed can be prepared to the feed with different components according to nutritional requirements at different stages; tremella, bolete and hericium erinaceus are added into the feed for piglets in order to clear away heat and toxic materials; dried orange peel, ginseng, white atractylodes rhizome and cassia twig are added into the feed for medium pigs in order to increase nutrient ingredients, improve growth speed and avoid toxicity; and lespedeza pilosa, Chinese fevervine, phoenix-tail fern, polygonum chinense head and mountain ramie root are added into the feed for big pigs in order to remove endotoxin in the pigs, and prevent, treat and reduce diseases. The preparation method is simple and low in cost.
Owner:凤台县关店乡开先生猪养殖场

Controlled-atmosphere storage method of bolete

The invention discloses a controlled-atmosphere storage method of bolete. The controlled-atmosphere storage method comprises the steps of: removing impurities, precooling, sorting, bagging, inflating and refrigerating and the like. The controlled-atmosphere storage method disclosed by the invention has the beneficial effects that the refreshing storage period of the fresh bolete is effectively prolonged and can be prolonged by 7-10 days; the method is simple and is easy in operation and good in refreshing effect; the mouthfeel and the appearance of the bolete are not obviously changed, the nutritional ingredients of the bolete are not basically lost, and the total refreshing storage period is 15-25 days; by proper matching ratio of oxygen and carbon dioxide, a low-temperature gas environment with low oxygen and high carbon dioxide is created, so that the bolete is in a living state of dormancy; and due to adoption of the method for refreshing storage of the bolete, no spoilage or deterioration of the bolete for long time is ensured, and the requirements of bulk bolete commodities for logistics transportation, refreshing storage and direct selling on shelves in supermarkets are met.
Owner:YUNNAN ENG AGRI TECH DEMONSTRATION GARDEN

Growth-promoting complex microbial inoculant for dahurian larch, and preparation method and application method thereof

The invention relates to a growth-promoting complex microbial inoculant for dahurian larch, and a preparation method and an application method thereof, belonging to the technical field of microbial inoculants. In order to solve the problems of low natural renewal survival rate and poor effect of the dahurian larch, the invention provides the growth-promoting complex microbial inoculant for the dahurian larch. The growth-promoting complex microbial inoculant is prepared by compounding a chroogomphus rutilus microbial inoculant and a boletus edulis spore suspension according to a certain mass-volume ratio. When lateral roots grow from dahurian larch seedlings, the growth-promoting complex microbial inoculant is applied to soil and can form effective mycorrhiza with the root system of the dahurian larch, so the growth of the dahurian larch is promoted; the survival rate of the dahurian larch seedlings in barren and arid soil can be effectively improved; renewal is promoted; the quality ofnursery stocks and the yield of crops are improved; and the purposes of growth promotion, seedling strengthening, high yield and maintenance are achieved. The growth-promoting complex microbial inoculant for the dahurian larch provided by the invention is applied to promoting growth and renewal of the dahurian larch in places having suffered from fires and felling, and can promote material circulation and energy flow of an ecological system.
Owner:RES CENT FOR ECO ENVIRONMENTAL SCI THE CHINESE ACAD OF SCI +1

Baked bolete food and preparation method thereof

The invention discloses a baked bolete food and a preparation method thereof. The baked bolete food is prepared from the following raw materials in parts by weight: 82-84 parts of boletes, 15-17 parts of flour, 1 part of butter, 0.5-3 parts of condiments and 0.5-1 part of salt, wherein the condiments comprise the following raw materials in percentage by weight: 50% of white sugar, 10% of monosodium glutamate, 10% of chilli powder, 10% of salt and 20% of peanut oil. The preparation method comprises the following steps: 1, sorting, cleaning, chopping, blanching, draining and dewatering; 2, conducting mixing into uniform pulp; 3, mixing the boletes and the flour into uniform pulp; 4, baking. The baked bolete food is relatively less in nutritive loss, crisp, fragrant and pleasant to taste, and has the effects of preserving the nutritional ingredients in the boletes to the greatest extent, preferably keeping the delicious flavor of the boletes and providing a health food which is delicious and nutrient.
Owner:HEILONGJIANG JOHNSUN BIOLOGICAL ENG CO LTD

Nucleic acid molecular primer, method and kit for identifying boletus mucilaginosus

The invention discloses a nucleic acid molecular primer, a method and a kit for identifying boletus mucilaginosus. The DNA sequence of the nucleic acid molecule primer is C50F: CTGTCGCAGATATAGATGTAGA; C50R: CTTGAGGAGCCAGAGTGT; the method for identifying the boletus mucilaginosus comprises the following steps: S1, extracting DNA of a boletus mucilaginosus sample to be detected; s2, carrying out PCR amplification by taking the sample DNA as a template for PCR amplification and taking nucleic acid molecular primers C50F and C50R as amplification primers; and S3, carrying out agarose gel electrophoresis detection on the PCR amplification product in the step S2. The nucleic acid molecular primer disclosed by the invention can be used for carrying out rapid molecular identification on the sporocarp and the strain of the boletus mucilaginosus, has good specificity, is less in material consumption (only 20mg), is simple in method, and can complete inspection within 2 hours.
Owner:JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY +1

Muscarinic liquid extraction process

The invention belongs to the technical field of muscarinic liquid extraction, particularly relates to a muscarinic liquid extraction process, and aims at solving the problems that an existing muscarinic liquid extraction mode is complex in operation and cannot meet use requirements, the following scheme is provided, and the method comprises the following steps: S1, preparing fungi; S2, performing weighing; S3, performing grinding; S4, performing heating; S5, loading into a test tube, centrifuging, and mixing the two supernatants; S6, heating and concentrating; and S7, sub-packaging and storing: preparing the fresh bolete bought last year in the step S1, sorting, washing, freezing and storing, taking out the bolete during use, placing the bolete in a greenhouse for unfreezing, and then airing the bolete. The device is convenient to operate, the extraction mode of the muscarinic liquid is simple, crushing and mixing are adopted, the extraction effect and efficiency of the muscarinic liquid are improved, supernate is extracted twice, waste is avoided, secondary filtration is adopted, the purity of the muscarinic liquid can be improved, and the use requirement can be met.
Owner:桂红珍

Health wine containing dahurian rose fruits and sweet osmanthus flower honey and preparation method of health wine

The invention discloses a health wine containing dahurian rose fruits and sweet osmanthus flower honey. The health wine is prepared from the following raw materials in parts by weight: 200-250 parts of dahurian rose fruits, 10-12 parts of black tomatoes, 10-15 parts of sweet osmanthus flower honey, 5-6 parts of pigskin, 3-4 parts of rock candy, 20-30 parts of chicken, 5-6 parts of mulberry leaf meal, 6-8 parts of rhizoma fagopyri dibotryis, 9-11 parts of unhusked rice, 7-8 parts of rape leaves, 6-8 parts of onions, 5-7 parts of green peppers, 10-12 parts of bolete, 3-4 parts of lobed kudzuvine roots, 2-3 parts of climbing fig stems, 1-2 parts of lagochilus leiacanthus fisch., 3-5 parts of fresh noble dendrobium stems, 1-2 parts of radix codonopsis pilosulae and 8-10 parts of nutritional additives. The dahurian rose fruits are used as main components for brewing the health wine, and the dahurian rose fruit has the efficacies of resisting aging, fatigue and radiation, lowering blood pressure, preventing and treating cancers, strengthening the body, tonifying yang, invigorating brain, improving intelligence, reinforcing the spleen to promote digestion, promoting blood circulation to restore menstrual flow, improving sleep and astringing the lung to relieve cough. In addition, a various of Chinese medicinal herbs such as noble dendrobium stems are used for preparing the health wine, and the health wine can achieve the effects of tonifying the stomach, promoting the secretion of body fluid, nourishing yin and clearing away heat after long-term use.
Owner:ANHUI TIANXIAFU JIUYE

Boletus aereus mother strain preservation method, preservation culture medium and preparation method thereof

According to the technical scheme, the invention provides a boletus aereus mother strain preservation method, a preservation culture medium and a preparation method thereof, and the preservation culture medium comprises 50-200 g of coarse sawdust, 100-400 g of fine sawdust, 25-125 g of coffee shells, 25-150 g of turfy soil, 1-5 g of monopotassium phosphate, 0.5-3 g of magnesium phosphate and 300-700 ml of water. The preservation culture medium and the preparation method thereof are low in cost and simple to operate, and the preservation method of the boletus aereus mother strain by using the preservation culture medium is long-term, stable, simple and convenient.
Owner:JINGHONG HONGZHEN AGRI TECH CO LTD

Edible mushroom buccal tablets and preparation method thereof

The invention discloses edible mushroom buccal tablets and a preparation method thereof. The edible mushroom buccal tablets are prepared from the following raw materials in percentage by mass: 60-65% of edible mushroom powder, 10-15% of sprouted tephrosia vogelii powder, 5-8% of a honeysuckle flower extracting solution, 4-6% of a chrysanthemum extracting solution, 3-5% of a lemongrass extracting solution, 2-5% of starch, 2-5% of cane sugar and 0.1-0.3% of magnesium stearate, wherein the total percentage by mass of the components is 100%. The edible mushroom powder is prepared by mixing shiitake mushrooms, pleurotus nebrodensis, agrocybe cylindracea, bolete, hericium erinaceus, hypsizygus marmoreus and white funguses in the mass ratio of the shiitake mushrooms to the pleurotus nebrodensis to the agrocybe cylindracea to the bolete to the hericium erinaceus to the ypsizygus marmoreus and to the white funguses being 3 to 2 to 2 to 3 to 1 to 1 to 3, and then performing ultra-fine pulverization. The edible mushroom buccal tablets disclosed by the invention provide amino acids, vitamins, minerals and protein which are necessary for human bodies, can prevent multiple diseases, and have good effects of improving the immunity of the human bodies and improving the cardiorespiratory function; besides, the edible mushroom buccal tablets have the effects of reducing blood pressure, reducing noise, reducing internal heat and calming the mind and are foods having notable efficacies of health preservation and health care.
Owner:福建绿宝食品集团有限公司

Anti-illness eel fattening feed and making method thereof

The invention discloses an anti-illness eel fattening feed and a making method thereof. The feed comprises the following raw materials: fine corn flour, bran, soybean meal, fish meal, cottonseed hull, cucumber, konjac gum, seaweed powder, tangerine, jujube, gardenia, hibiscus rosa-sinensis, sow thistle, cactus powder, wheat germ oil, garlic stem, chinese chive stem, boletus, green pea, hay, straw, leek root, onion root, wisteria, Coptis powder, a feed attractant, and a proper amount of water. The feed provided by the invention is meticulously designed according to the nutritional requirements and diet habits of eel, has the characteristics of reasonable collocation, nutrition and health and adequate energy, and can effectively promote the eel growth and weight gain, promote the rapid growth, shorten the growth cycle, increase the eel yield and prevent eel illness, thus increasing the economic benefits of eel culture.
Owner:凤阳县兴科农业生态发展有限公司

Seasoning chili oil contributing to enriching brain and processing technology of seasoning chili oil

The invention discloses seasoning chili oil contributing to enriching the brain and a processing technology of the seasoning chili oil, and relates to the technical field of food processing. The seasoning chili oil is mainly prepared from dry red chili , rapeseed oil, duck meat, dishcloth gourds, cucumbers, lotus leaves, bolete dry powder, smoked plum serosity, water spinach juice, chopped walnut kernels, red bean powder, pig's trotter minced meat, a glossy privet fruit extracting solution, an asiatic cornelian cherry fruit extracting solution, and an albizia bark extracting solution. The seasoning chili oil disclosed by the invention is bright in color, has full-bodied chili oil fragrance, is moderate in concentration, and is good in mouth feel. A special pathogenic fire reducing soup is prepared, so that the seasoning chili oil is delicious and health-care, and after eating the chili oil, people do not need to consider the problem of suffering from excessive internal heat; in addition, walnuts also have the function of enriching the brain, and traditional Chinese medicines of glossy privet fruits, asiatic cornelian cherry fruits and the like are eaten together with the walnuts, so that the seasoning chili oil contributes to the health of bodies.
Owner:HEFEI LONGLE FOODS