81 results about "Boletales" patented technology

The invention discloses bolete extracting solution and beverages, belonging to the field of edible fungi beverages. The preparation method of the bolete extracting solution comprises the following steps of: extracting crushed bolete dry powder or fresh bolete slurry in water, then filtering to obtain filtrate, centrifuging the filtrate, and collecting supernate. By utilizing the bolete extracting solution, different flavors of bolete beverages can be prepared. The bolete beverage has rich nutrient components and simultaneously contains a great deal of polysaccharides with the functions of improving body immunity, reducing the blood sugar levels and cholesterol, resisting the ageing, and the like; secondly, the invention is convenient to carry and ready to drink and solves the problem that fresh bolete is difficult to store and transport; the invention can be also used as raw materials of beverages and food processing and prepared into different flavors of beverages; and besides, the invention has simple method, low cost and no environmental pollution.

The invention relates to an establishing method of symbiont of cyclobalanopsis glaucoides and bolete, belonging to the field of biotechnology (plant tissues and fungal culture). In the research of mycorrhizal fungi, a stable pure symbiont of plants and fungus is difficult to establish. At present, bolete can not be cultivated artificially easily, belongs to mycorrhizal fungi capable of realizing mutualistic symbiosis with the plant, and has symbiotic relationship with pinaceae plants, fagaceae plants and the like under natural condition. According to the establishing method, cyclobalanopsis glaucoides seed and generalized delicious beef liver mushroom entity collected in the Wuding lion rock are used as materials, so that callus and mycelium are respectively induced successfully and are cultured together in an innovation manner, and a simple and stable pure-symbiont system is established under the sterile state. Important basis is provided for the symbiotic relationship and the symbiotic mechanism of bolete, cyclobalanopsis glaucoides and the other plants and the molecular mechanism of the beef liver mushroom entity and the like, and the method use for reference is provided for research on other macro fungi and symbiotic plants.

The invention discloses bolete soft sweet containing fine proteins. The bolete soft sweet consists of the following raw materials in parts by weight: 220-230 parts of maltose, 100-110 parts of cane sugar, 45-50 parts of starch syrup, 3-4 parts of agar, 8-9 parts of edible gelatin, 20-30 parts of bolete, 30-40 parts of brown rice, 20-30 parts of milk powder, 12-15 parts of gadus protein powder, 5-6 parts of Japanese ampelopsis root, 4-5 parts of angelica dahurica, 4-5 parts of Mongolian snakegourd root, 5-6 parts of platycodon root and 4-5 parts of fragrant solomonseal rhizome. In the bolete soft sweet containing the fine proteins disclosed by the invention, the milk powder and the gadus protein powder are added, so that fine proteins essential for human bodies can be provided, and rich nutrition is supplied; moreover, extracts of Chinese medicinal materials such as the Japanese ampelopsis root, the Mongolian snakegourd root and the like are added, so that the bolete soft sweet can clear away heat and toxic materials, dissipate heat, resist cancers, promote the secretion of saliva or body fluid, quench thirst and the like, and has a certain health care function.

The present invention discloses one kind of Chinese chestnut mycorrhiza preparation obtained with Rhizopogon and Boletus edulis and through simultaneous culturing. The Chinese chestnut mycorrhiza preparation can raise the fertilizer and water absorbing ability of Chinese chestnut root system, expand the absorption area, decompose soil nutrients, strengthen drought fighting capacity, and secrete hormone and organic acid to enhance physiological activity of root system.

The invention relates to a production increasing method for mycorrhizal edible fungi in forests, which comprises the steps of: eliminating non-target host plants and mycorrhiza of non-target mycorrhizal fungi in a forest on the premise of identifying and positioning bolete host plants and mycorrhiza distribution area in a traditional artificial forest or a natural forest, and supplementing mycorrhiza seedlings inoculated with the bolete. The updated treatment technology is beneficial to faster enlarging fungal distribution ranges and fungal dominance degree in the traditional forest land producing the bolete so as to connect bolete ponds in the forest into a whole, thereby further greatly improving the yield of the bolete.

The invention relates to a culture method for inhibiting the browning of bolete mycelium and belongs to the technical field of organism (macro fungi culture). The artificial culture of bolete is difficult to realize at present, and bolete fruiting bodies completely rely on wild picking. In recent years, because of the reasons of climate change, ecological damage and the like, the natural yield isseriously reduced, and the price is high. The growth of bolete hyphae on an artificial culture medium is slow, the culture medium and the hyphae easily brown after the hyphae grow for a period of time, and the subsequent growth is influenced. According to the method provided by the invention, a strain of unopened boletus edulis fruiting body produced in Yunnan is adopted as materials, paths such as mycelium inducing, mycelium activation and the like are adopted, and a culture medium capable of inhabiting or reducing the browning is provided. The culture medium has the characteristics that ingredients are clear and simple, the cost is low, the growth of the mycelium is fast, the bacterial colony is white and clean, and the like. Important foundation is laid for the scaled culture, artificial or semi-artificial domestication and the like of the bolete mycelium.

The invention discloses a flax liver calming bolete sundry fungus soup base and a preparation method thereof. The flax liver calming bolete sundry fungus soup base is characterized by being prepared by the following raw materials including, by weight, flax, platycladi seeds, oroxylum indicum, hematoxylon, calamus, solanum lyratum thumb roots, roots of privet-like premna, gerbera, bolete, black fungus, grifron maitake, garlic, green onion, fresh ginger, cassava starch, salt, oat powder and anise; the soup base is prepared by the working procedures including cleaning, raw material processing, mixing, decontamination and sterilization bagging. The flax liver calming bolete sundry fungus soup base has the advantages that the taste is delicious, the storage is convenient, the liver calming effect is achieved, in addition, the preparation technology is more simple and hygeian.

The invention discloses an artificially domesticated phlcbopus portentosus strain HZ18006 and a SSR marker fingerprint thereof. The strain has the ability to significantly increase the yield of fruiting bodies, is deposited in the China General Microbiological Culture Collection Center (CGMCC) on March 18, 2019 with the preservation number of CGMCC No.17080. The laboratory and production practiceconfirm that the strain has high strain vigor and stable genetic characteristics, the fruiting speed is high and the fruiting is tidy in the late stage, the growth speed is high, the needs of large-scale factory cultivation are met, harvesting can be completed at one time in a best harvesting period, and the harvesting process is greatly simplified and labor is saved; and excellent biological growth characteristics such as simple fruiting body cultivation method, extensive management, high fruiting and high yield are further achieved. The SSR marker fingerprint of the HZ18006 strain is composed of 10 pairs of SSR markers, and is combined with an accurate quantitative capillary electrophoresis fluorescence detection method for rapid identification of the HZ18006 strain.

The invention belongs to the field of food seasonings and discloses edible mushroom compound nutritional salt and a preparation method thereof. The edible mushroom compound nutritional salt is composed of, by mass percentage, 60-90% of edible salt and 10-40% of edible mushroom powder, wherein edible mushrooms include tricholoma matsutake, sparassis crispa, bolete, collybia albuminosa and red mushrooms. Wild edible mushroom plant organs and edible salt are selected as the raw materials, extraction processing and ultrafine powder processing techniques and technology are adopted to extract effective active ingredients such as amino acids, polysaccharides, mineral elements, flavones, sterols and adenosine in the edible mushrooms, the extracted effective active ingredients are combined with theedible salt, and synthetic essence and perfume and the like are not added, so that the prepared nutritional salt can improve human immunity and resist tumor and radiation and is natural, healthful, green and functional.

The present invention discloses a digestion promoting carassius auratus feed, which is prepared from the following raw materials, by weight, 120 to 130 parts of millet powder, 50 to 60 parts of wheat bran, 30 to 40 parts of flour, 30 to 40 parts of potato powder, 5 to 6 parts of date powder, 6 to 9 parts of hawthorn powder, 10 to 12 parts of brown sugar, 6 to 7 parts of corn flavor water, 2 to 4 parts of boletus, 3 to 4 parts of beta vulgaris seeds, 4 to 5 parts of green bean vine, 5 to 6 parts of vicia faba skin, 3 to 4 parts of russula nigricans, 1 to 2 parts of magnolia seeds, 1 to 2 parts of myrcia, 3 to 4 parts of mentha haplocalyx, 5 to 6 parts of an auxiliary agent, and a proper amount of water. The digestion promoting carassius auratus feed is low in cost and convenient to process, store and feed. The digestion promoting carassius auratus feed is rich in various proteins, trace elements and other nutrients. The digestion promoting carassius auratus feed has palatability and rich nutrients, and promotes the growth. The added hawthorn powder, magnolia seeds, myrcia and the like have the effects of digestion promoting and stomach invigorating so that the food intake of carassius auratus is increased and the health growth of the carassius auratus is promoted after the carassius auratus eats the feed.

The invention discloses an edible fungus noodle, which is composed of the following raw materials in parts by weight: 80 to 90 parts of barley, 45 to 55 parts of vigna eylindrica, 25 to 35 parts of seed of Job's tears, 10 to 15 parts of pumpkin flower, 20 to 25 parts of bolete, 20 to 25 parts of pleurotus nebrodensis, 18 to 24 parts of pholiota nameko, 1 to 2 parts of white glorybower, 1 to 3 parts of hawthorn, 1 to 2 parts of viola inconspicua, 1 to 2 parts of hollyhock root, 1 to 2 parts of noodle additive, and a proper amount of water. The preparation method takes barley, vigna eylindrica, and seed of Job's tears as the main raw materials; wherein the barley has the functions of treating diabetes, removing heat toxin, tonifying qi and the middle, relieving the fatigue, strengthening the blood vessel, moistening the skin, and relieving the hunger; the vigna eylindrica contains following components: protein, fat, sugar, phosphor, calcium, iron, zinc, vitamin B1, vitamin B2, nicotinic acid, pantothenic acid, stigmasterol, phosphatide, cyanophoric glycoside, blood coagulation factor, and the like; the bolete has the functions of fortifying the spleen, removing the dampness, clearing the heat, relieving the temper, nourishing the blood, regulating the middle, expelling the wind and cold, relaxing the muscles, activating the blood, tonifying deficiency, and refreshing; and the pleurotus nebrodensis has the functions of removing food retention, killing parasites, relieving cough, modulating the human physiological balance, and strengthening the human immunity.

The invention discloses specific primers for identifying Chiua virens and a method for identifying Chiua virens by the specific primers. The specific primers for identifying Chiua virens are CVf and CVr. A DNA sequence of CVf is CTTACCGAACGGAMGGGATAACACC and a DNA sequence of CVr is AGAAGCAAAGNACAGGAAAAGCATA. The method for identifying Chiua virens by the specific primers comprises the following steps of extracting a total DNA of a mixed bolete sample, carrying out specific primer PCR amplification, and carrying out agarose gel electrophoresis detection of amplification products to identify if the mixed bolete sample is mixed with toxic and unclean Chiua virens. The method for identifying Chiua virens by the specific primers does not need a PCR product sequencing process and can realize rapid and accurate identification, wherein generally, time from mixed bolete sample taking to identification result production is in a range of 2 to 3 hours.

The invention discloses feed for pigs in layered raising and a preparation method of the feed for the pigs in the layered raising. The feed can be prepared to the feed with different components according to nutritional requirements at different stages; tremella, bolete and hericium erinaceus are added into the feed for piglets in order to clear away heat and toxic materials; dried orange peel, ginseng, white atractylodes rhizome and cassia twig are added into the feed for medium pigs in order to increase nutrient ingredients, improve growth speed and avoid toxicity; and lespedeza pilosa, Chinese fevervine, phoenix-tail fern, polygonum chinense head and mountain ramie root are added into the feed for big pigs in order to remove endotoxin in the pigs, and prevent, treat and reduce diseases. The preparation method is simple and low in cost.

The invention discloses a controlled-atmosphere storage method of bolete. The controlled-atmosphere storage method comprises the steps of: removing impurities, precooling, sorting, bagging, inflating and refrigerating and the like. The controlled-atmosphere storage method disclosed by the invention has the beneficial effects that the refreshing storage period of the fresh bolete is effectively prolonged and can be prolonged by 7-10 days; the method is simple and is easy in operation and good in refreshing effect; the mouthfeel and the appearance of the bolete are not obviously changed, the nutritional ingredients of the bolete are not basically lost, and the total refreshing storage period is 15-25 days; by proper matching ratio of oxygen and carbon dioxide, a low-temperature gas environment with low oxygen and high carbon dioxide is created, so that the bolete is in a living state of dormancy; and due to adoption of the method for refreshing storage of the bolete, no spoilage or deterioration of the bolete for long time is ensured, and the requirements of bulk bolete commodities for logistics transportation, refreshing storage and direct selling on shelves in supermarkets are met.

The invention relates to a growth-promoting complex microbial inoculant for dahurian larch, and a preparation method and an application method thereof, belonging to the technical field of microbial inoculants. In order to solve the problems of low natural renewal survival rate and poor effect of the dahurian larch, the invention provides the growth-promoting complex microbial inoculant for the dahurian larch. The growth-promoting complex microbial inoculant is prepared by compounding a chroogomphus rutilus microbial inoculant and a boletus edulis spore suspension according to a certain mass-volume ratio. When lateral roots grow from dahurian larch seedlings, the growth-promoting complex microbial inoculant is applied to soil and can form effective mycorrhiza with the root system of the dahurian larch, so the growth of the dahurian larch is promoted; the survival rate of the dahurian larch seedlings in barren and arid soil can be effectively improved; renewal is promoted; the quality ofnursery stocks and the yield of crops are improved; and the purposes of growth promotion, seedling strengthening, high yield and maintenance are achieved. The growth-promoting complex microbial inoculant for the dahurian larch provided by the invention is applied to promoting growth and renewal of the dahurian larch in places having suffered from fires and felling, and can promote material circulation and energy flow of an ecological system.

The invention discloses a nucleic acid molecular primer, a method and a kit for identifying boletus mucilaginosus. The DNA sequence of the nucleic acid molecule primer is C50F: CTGTCGCAGATATAGATGTAGA; C50R: CTTGAGGAGCCAGAGTGT; the method for identifying the boletus mucilaginosus comprises the following steps: S1, extracting DNA of a boletus mucilaginosus sample to be detected; s2, carrying out PCR amplification by taking the sample DNA as a template for PCR amplification and taking nucleic acid molecular primers C50F and C50R as amplification primers; and S3, carrying out agarose gel electrophoresis detection on the PCR amplification product in the step S2. The nucleic acid molecular primer disclosed by the invention can be used for carrying out rapid molecular identification on the sporocarp and the strain of the boletus mucilaginosus, has good specificity, is less in material consumption (only 20mg), is simple in method, and can complete inspection within 2 hours.

The invention belongs to the technical field of muscarinic liquid extraction, particularly relates to a muscarinic liquid extraction process, and aims at solving the problems that an existing muscarinic liquid extraction mode is complex in operation and cannot meet use requirements, the following scheme is provided, and the method comprises the following steps: S1, preparing fungi; S2, performing weighing; S3, performing grinding; S4, performing heating; S5, loading into a test tube, centrifuging, and mixing the two supernatants; S6, heating and concentrating; and S7, sub-packaging and storing: preparing the fresh bolete bought last year in the step S1, sorting, washing, freezing and storing, taking out the bolete during use, placing the bolete in a greenhouse for unfreezing, and then airing the bolete. The device is convenient to operate, the extraction mode of the muscarinic liquid is simple, crushing and mixing are adopted, the extraction effect and efficiency of the muscarinic liquid are improved, supernate is extracted twice, waste is avoided, secondary filtration is adopted, the purity of the muscarinic liquid can be improved, and the use requirement can be met.

The invention discloses a health wine containing dahurian rose fruits and sweet osmanthus flower honey. The health wine is prepared from the following raw materials in parts by weight: 200-250 parts of dahurian rose fruits, 10-12 parts of black tomatoes, 10-15 parts of sweet osmanthus flower honey, 5-6 parts of pigskin, 3-4 parts of rock candy, 20-30 parts of chicken, 5-6 parts of mulberry leaf meal, 6-8 parts of rhizoma fagopyri dibotryis, 9-11 parts of unhusked rice, 7-8 parts of rape leaves, 6-8 parts of onions, 5-7 parts of green peppers, 10-12 parts of bolete, 3-4 parts of lobed kudzuvine roots, 2-3 parts of climbing fig stems, 1-2 parts of lagochilus leiacanthus fisch., 3-5 parts of fresh noble dendrobium stems, 1-2 parts of radix codonopsis pilosulae and 8-10 parts of nutritional additives. The dahurian rose fruits are used as main components for brewing the health wine, and the dahurian rose fruit has the efficacies of resisting aging, fatigue and radiation, lowering blood pressure, preventing and treating cancers, strengthening the body, tonifying yang, invigorating brain, improving intelligence, reinforcing the spleen to promote digestion, promoting blood circulation to restore menstrual flow, improving sleep and astringing the lung to relieve cough. In addition, a various of Chinese medicinal herbs such as noble dendrobium stems are used for preparing the health wine, and the health wine can achieve the effects of tonifying the stomach, promoting the secretion of body fluid, nourishing yin and clearing away heat after long-term use.

According to the technical scheme, the invention provides a boletus aereus mother strain preservation method, a preservation culture medium and a preparation method thereof, and the preservation culture medium comprises 50-200 g of coarse sawdust, 100-400 g of fine sawdust, 25-125 g of coffee shells, 25-150 g of turfy soil, 1-5 g of monopotassium phosphate, 0.5-3 g of magnesium phosphate and 300-700 ml of water. The preservation culture medium and the preparation method thereof are low in cost and simple to operate, and the preservation method of the boletus aereus mother strain by using the preservation culture medium is long-term, stable, simple and convenient.

The invention discloses an anti-illness eel fattening feed and a making method thereof. The feed comprises the following raw materials: fine corn flour, bran, soybean meal, fish meal, cottonseed hull, cucumber, konjac gum, seaweed powder, tangerine, jujube, gardenia, hibiscus rosa-sinensis, sow thistle, cactus powder, wheat germ oil, garlic stem, chinese chive stem, boletus, green pea, hay, straw, leek root, onion root, wisteria, Coptis powder, a feed attractant, and a proper amount of water. The feed provided by the invention is meticulously designed according to the nutritional requirements and diet habits of eel, has the characteristics of reasonable collocation, nutrition and health and adequate energy, and can effectively promote the eel growth and weight gain, promote the rapid growth, shorten the growth cycle, increase the eel yield and prevent eel illness, thus increasing the economic benefits of eel culture.

The invention discloses seasoning chili oil contributing to enriching the brain and a processing technology of the seasoning chili oil, and relates to the technical field of food processing. The seasoning chili oil is mainly prepared from dry red chili , rapeseed oil, duck meat, dishcloth gourds, cucumbers, lotus leaves, bolete dry powder, smoked plum serosity, water spinach juice, chopped walnut kernels, red bean powder, pig's trotter minced meat, a glossy privet fruit extracting solution, an asiatic cornelian cherry fruit extracting solution, and an albizia bark extracting solution. The seasoning chili oil disclosed by the invention is bright in color, has full-bodied chili oil fragrance, is moderate in concentration, and is good in mouth feel. A special pathogenic fire reducing soup is prepared, so that the seasoning chili oil is delicious and health-care, and after eating the chili oil, people do not need to consider the problem of suffering from excessive internal heat; in addition, walnuts also have the function of enriching the brain, and traditional Chinese medicines of glossy privet fruits, asiatic cornelian cherry fruits and the like are eaten together with the walnuts, so that the seasoning chili oil contributes to the health of bodies.

The invention discloses a yine abrus heat clearing bolete and bacterium soup base and a preparation method thereof. The yine abrus heat clearing bolete and bacterium soup base is characterized by comprising, by weight, yine abrus, radix glehniae, pinenut kernels, axillary choerospondias fruits, juice of Chinese bananas, ginkgo roots, youngia japonica, Chinese gall leaven, boletes, black fungi, grifron maitake, garlic, green onion, ginger, cassava starch, salt, oat flour and anise; all the raw materials are subjected to washing, treating, mixing, impurity removing, sterilizing, bagging and other procedures to be made into the yine abrus heat clearing bolete and bacterium soup base. The yine abrus heat clearing bolete and bacterium soup base is delicious in taste and convenient to store, has the effect of clearing heat and is simpler and more sanitary in preparation process.

The invention discloses a heat-clearing bamboo-shaving bolete assorted-mushroom soup base and a preparation method thereof. The soup base is characterized by being prepared from the following raw materials in parts by weight: bamboo shaving, lily, acorn, yunnan supplejack root, polygala japonica, mapleleaf excoecaria seedling, berberis heteropoda, Japanese snailseed root, bolete, black fungus, grifron maitake, garlic, green onion, ginger, cassava starch, edible salt, oat powder and star anise. The soup base is prepared by washing, raw material treating, mixing, impurity removing, sterilizing, bagging and other processes. The soup base has delicious taste, is convenient to store, and has a heat-clearing effect; and the preparation process is simple and sanitary.