Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid molecular primer, method and kit for identifying boletus mucilaginosus

A technology of nucleic acid molecules and detection kits, which is applied in the field of detection of edible fungi by molecular biology methods, and achieves the effect of simple method and good specificity

Active Publication Date: 2021-10-15
JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY +1
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report on molecular identification methods related to S.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid molecular primer, method and kit for identifying boletus mucilaginosus
  • Nucleic acid molecular primer, method and kit for identifying boletus mucilaginosus
  • Nucleic acid molecular primer, method and kit for identifying boletus mucilaginosus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Acquisition and Genomic DNA Extraction of Lactobacillus mucilaginus

[0036] 1. From Mopanshan National Forest Park (101.96 ° E, 23.95 ° N) in Xinping Yi Autonomous County, Yunnan Province, the fruiting body of Boletus mucilaginous caps that has grown vigorously and has not been opened (see figure 1 ), put it in the ice box and take it back to the laboratory on the same day, and immediately separate it in the ultra-clean workbench to obtain the tissue block for culture, the tissue block is 5×5mm.

[0037] 2. Inoculate the cut tissue pieces into the plate culture medium, and the culture medium components are: potato dextrose agar (PDA) dry powder (40g / L), malt extract powder (10g / L), vitamin B1 (50mg / L ), complex vitamin B tablets (1 tablet / L, each tablet contains vitamin B1 3mg, vitamin B2 1.5mg, vitamin B6 0.2mg, niacinamide 10mg, calcium pantothenate 1mg), potassium myristate (0.5-1mmol / L) .

[0038] 3. Inoculate 10 plate repeats, place them in a constant...

Embodiment 2

[0042] Embodiment 2: the PCR amplification of the milk boletus specific primer of sticky cover

[0043]Specific nucleic acid molecular primers C50F and C50R were designed according to the C50 gene family gene (Gene ID 12967) of Lactobacillus colicapsus Peptidase family, C50F: 5'-CTGTCGCAGATAGATGTAGA-3' (SEQ ID NO.2) and C50R: 5'-CTTGAGGAGCCAGAGTGT -3' (SEQ ID NO.3), the primer was synthesized by Shanghai Biological Engineering Co., Ltd. The total volume of the PCR amplification reaction system is 50 μL: DNA template 1 μL, Taq DNA polymerase (5U / μL) 1 μL, upstream primer C50F (10 μmol / L) 1 μL, downstream primer C50R (10 μmol / L) 1 μL, 10×Buffer 5 μL , 2mmol / L dNTP 5μL, 25mmol / L MgCl 2 3 μL, make up ddH 2 0 to 50 μL. The DNA templates are the fruiting bodies and hyphae DNAs finally obtained in Example 1, respectively. The reaction program was: pre-denaturation at 94°C for 4 minutes; 35 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid molecular primer, a method and a kit for identifying boletus mucilaginosus. The DNA sequence of the nucleic acid molecule primer is C50F: CTGTCGCAGATATAGATGTAGA; C50R: CTTGAGGAGCCAGAGTGT; the method for identifying the boletus mucilaginosus comprises the following steps: S1, extracting DNA of a boletus mucilaginosus sample to be detected; s2, carrying out PCR amplification by taking the sample DNA as a template for PCR amplification and taking nucleic acid molecular primers C50F and C50R as amplification primers; and S3, carrying out agarose gel electrophoresis detection on the PCR amplification product in the step S2. The nucleic acid molecular primer disclosed by the invention can be used for carrying out rapid molecular identification on the sporocarp and the strain of the boletus mucilaginosus, has good specificity, is less in material consumption (only 20mg), is simple in method, and can complete inspection within 2 hours.

Description

technical field [0001] The invention relates to the technical field of detection of edible fungi by molecular biology methods, in particular to a nucleic acid molecular primer, a method and a kit for identifying Suillus bovinus. Background technique [0002] The genus Suillus belongs to Fungi, Basidiomycota, Agaricomycetes, Boletales, and Suillaceae. Mycorrhizal fungi can form a symbiotic relationship with a variety of trees, especially coniferous species. There are 509 records of boletus species in Index Fungorum (http: / / www.indexfungorum.org). In the genus Boletus, most species are edible except for a few species that are poisonous or bitter and cannot be eaten. Suillus bovinus is mainly distributed in coniferous forests. It is a very rare edible fungus. It is widely used in cooking in Yunnan, Guangdong, Guangxi and other regions. It is rich in various proteins, vitamins and antioxidant active substances. The content of carbohydrates and fats is very low, and it is a ve...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/686C12Q1/04C12N15/11C12R1/645
CPCC12Q1/6895C12Q1/686C12Q2565/125
Inventor 陈佳佳刘国华宋杰于健陈义彬杨广荣
Owner JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY