Method for identifying and detecting boletus bainiugan dentinger or components of boletus bainiugan dentinger
A detection method, the technology of white boletus, is applied in the field of fluorescent PCR identification and detection, which can solve the problems that the identification cannot meet very high standards, and achieve the effects of improving technical influence, accurate identification results, and short detection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0020] 1. An identification and detection method of boletus or its components, the detection method is a fluorescent PCR detection method. The white boletus that the present invention refers to is Boletus bainiugan Dentinger.
[0021] Further, the primers used in the detection method of the present invention are: upstream primer (F) 5'-GGATCATTATCGAGTTAGAC-3'; downstream primer (R) 5'-TGGACATGCAATAGAGTA-3'.
[0022] Further, the probe used in the detection method of the present invention is: probe (P)(HEX)TTCCTCGGACTCTCCTTCCTAGT (Eclipse).
[0023] Further, the reaction system of the detection method of the present invention is:
[0024] Reaction system components Sample volume Final concentration 2×premix Ex Taq(Probe qPCR) 12.5μL 1× Upstream primer (F) (10μmol / L) 0.5μL 0.2 µmol / L Downstream primer (R) (10µmol / L) 0.5μL 0.2 µmol / L Probe (P) (10µmol / L) 0.5μL 0.2 µmol / L DNA (10-100ng / μL) 2 μL (0.8-8ng) wxya 2 o
...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com