Unlock instant, AI-driven research and patent intelligence for your innovation.

RNA interference sequence and recombinant interference plasmid of fucosyl transferase I and IV for suppressing synthesis of LeY carbohydrate antigen

A technology for fucosyl and antigen synthesis, applied in DNA/RNA fragments, recombinant DNA technology, medical preparations containing active ingredients, etc., can solve problems such as toxicity and side effects

Inactive Publication Date: 2008-07-23
燕秋
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the treatment strategies for tumors mainly adopt comprehensive methods such as surgery, radiotherapy and chemotherapy, but each method still has limitations and can produce a certain degree of toxic and side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RNA interference sequence and recombinant interference plasmid of fucosyl transferase I and IV for suppressing synthesis of LeY carbohydrate antigen
  • RNA interference sequence and recombinant interference plasmid of fucosyl transferase I and IV for suppressing synthesis of LeY carbohydrate antigen
  • RNA interference sequence and recombinant interference plasmid of fucosyl transferase I and IV for suppressing synthesis of LeY carbohydrate antigen

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0071] Example 1 Construction of recombinant FUT1 interference plasmid

[0072] ①According to the SiRNA design software, the DNA template sequence of the recombinant FUT1 interference plasmid for anti-tumor growth is obtained, which is based on the sequence of the regulatory region and the coding region of the FUT1 gene to construct the interference plasmid. The 5'end of each chain contains a HindIII or BamHI restriction site (underlined). details as follows:

[0073] FUT1-1(5’-3’)

[0074] GATCC TGGCCGGTTTGGTAATCAGTTCAAGAGACTGATTACCAAACCGGCCAGGA

[0075] AGCTT CCTGGCCGGTTTGGTAATCAGTCTCTTGAACTGATTACCAAACCGGCCAG

[0076] FUT1-2(5’-3’)

[0077] GATCC AGACTTTGCCCTGCTCACATTCAAGAGATGTGAGCAGGGCAAAGTCTGGA

[0078] AGCTT CCAGACTTTGCCCTGCTCACATCTCTTGAATGTGAGCAGGGCAAAGTCTG

[0079] ②Design the DNA template sequence of the FUT1 interference plasmid inserted into the vector according to the pSilencer-4.1-CMV-neo vector structure information, that is, based on the multi-cloning restric...

example 2

[0083] Example 2 Construction of recombinant FUT4 interference plasmid

[0084] ①According to the SiRNA design software, the DNA template sequence of the recombinant FUT4 interference plasmid for anti-tumor growth is obtained, which is based on the sequence of the regulatory region and coding region of the FUT4 gene to construct the interference plasmid. The 5'end of each chain contains a HindIII or BamH I restriction site (underlined). details as follows:

[0085] FUT4-1(5’-3’)

[0086] GATCC GCCTGGCAAGTAACCTCTTCTCAAGAGAAAGAGGTTACTTGCCAGGCGGA

[0087] AGCTT CCAGCCTGGCAAGTAACCTCTTTCTCTTGAGAAGAGGTTACTTGCCAGGCG

[0088] FUT4-2(5`-3`)

[0089] GATCC GTAACCTCTTCAACTGGACTTCAAGAGAGTCCAGTTGAAGAGGTTACGGA

[0090] AGCTT CCGTAACCTCTTCAACTGGACTCTCTTGAAGTCCAGTTGAAGAGGTTACG

[0091] ②Design the DNA template sequence of the FUT4 interference plasmid inserted into the vector according to the pSilencer-4.1-CMV-neo vector structure information, that is, based on the multi-cloning restrictio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a RNA interference sequence and a restructuring interference plasmid of the fucosyltransferase I and IV used for inhibiting the synthesis of LeY saccharide antigen, which mainly comprises: the DNA sequence of seven FUT1 / FUT4 SiRNA templates of fucosyltransferase I and seven FUT1 / FUT4 SiRNA templates of fucosyltransferase IV are screened, seven FUT1 and seven FUT4 restructuring interference plasmid are respectively constructed on the base of polyclonal specific enzyme cutting sites of the RNA interference carried (pSilencer-4.1-CMV neo), and the interference plasmid is used as antitumor drugs. The RNA interference sequence and a restructuring interference plasmid of the fucosyltransferase I and IV used for inhibiting the synthesis of LeY saccharide antigen has the advantages of obvious function of inhibiting tumor growing, high efficiency, high safety and economic tumor gene therapeutic mode.

Description

Technical field [0001] The invention relates to a specific DNA sequence and a recombinant interference plasmid constructed according to the sequence. Background technique [0002] Malignant tumor is a relatively difficult disease, and there is no ideal treatment method. At present, the treatment strategy for tumors is mainly to adopt comprehensive methods such as surgery, radiotherapy and chemotherapy, but each method still has limitations and can produce a certain degree of toxic side effects. Summary of the invention [0003] The purpose of the present invention is to provide an RNA interference of fucosyltransferases I and IV for inhibiting the synthesis of LeY tumor oligosaccharide antigens, which is constructed based on the synthesis of tumor-specific sugar antigens and tumor growth, infiltration, metastasis and other molecular mechanisms Sequence and recombinant interference plasmid. The present invention mainly uses RNAi (RNAi, RNA interference) technology to target speci...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C07H21/04C12N15/66C12N15/63A61K31/7088A61K48/00A61P35/00C12N15/113
Inventor 张振波闫杰刘基巍富力王晓琦燕秋
Owner 燕秋