Unlock instant, AI-driven research and patent intelligence for your innovation.

Tuberculosis antigen specific whole blood IFN-gamma diagnosis kit, method for producing the same and method for using same

A technology of diagnostic kits and application methods, which can be used in biological testing, material inspection products, measuring devices, etc., and can solve problems such as blocking the spread and prevalence of tuberculosis

Inactive Publication Date: 2009-07-29
范雄林
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention aims at the difficulties and shortcomings of the above-mentioned diagnostic methods, and proposes a tuberculosis antigen-specific whole blood IFN-γ diagnostic method, which can realize early, rapid and specific diagnosis of tuberculosis patients and infected persons, and is effective in blocking tuberculosis. Transmission and prevalence, with major implications for tuberculosis control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tuberculosis antigen specific whole blood IFN-gamma diagnosis kit, method for producing the same and method for using same
  • Tuberculosis antigen specific whole blood IFN-gamma diagnosis kit, method for producing the same and method for using same
  • Tuberculosis antigen specific whole blood IFN-gamma diagnosis kit, method for producing the same and method for using same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1 The amplification of the target gene of the present invention and the construction of expression vector

[0036] (1) First: design primers to amplify Rv3875 and Rv3874

[0037] Rv3875 upstream: GC GGATCC ATGACAGAGCAGCAGTG (SEQ.ID.NO.2)

[0038] Description: Single underline represents: BamHI restriction site

[0039] Downstream of Rv3875:

[0040] TGCGAACATCCCAGTGACGTTGCCTTC (SEQ.ID.NO.3)

[0041] Description: double underscore means: linker gene sequence

[0042] Rv3874 upstream:

[0043] ATGGCAGAGATGAAGACCGATG (SEQ.ID.NO.4)

[0044] Description: double underscore means: linker gene sequence

[0045] Downstream of Rv3874: CC AAGCTT TCAGAAGCCCATTTGCGAG (SEQ.ID.NO.5)

[0046] Note: The single underline represents the HindIII restriction site

[0047] Using the genomic DNA of the standard strain of Mycobacterium tuberculosis (H37Rv) as a template, the above primers were used to amplify CFP21 and MPT64 respectively. The PCR reaction conditions ...

specific Embodiment 2

[0050] Specific Example 2 High-efficiency expression of recombinant protein Rv3875-Rv3874 (SEQ.ID.NO.6) in Escherichia coli

[0051] The constructed expression vector pPro610 was transformed into Escherichia coli BL21(DE3) strain and highly expressed. The steps are as follows: activate the bacterium, transfer to 1 liter of LB culture medium and shake for 2-3 hours, and then induce with IPTG (1 mM) at 37° C. for different time. The cells were collected by centrifugation, added with 2×SDS loading buffer, and bathed in boiling water for 3 minutes, and the expression product was confirmed by 12.5% ​​SDS-PAGE electrophoresis. see results figure 2 . Preserving the bacteria in glycerol is the engineering bacteria.

specific Embodiment 3

[0052] Purification of Specific Example 3 Recombinant Protein Rv3875-Rv3874

[0053] Centrifuge at 10000rpm for 10min to collect the induced expression engineered bacteria, and carry out SDS-PAGE electrophoresis detection on the lysed supernatant and the precipitate respectively. As a result, the required recombinant protein is found in the supernatant and the precipitate, and the protein purification operation follows the Ni-NTA purification system ( Invitrogen, USA) instructions. A brief overview of the steps is as follows, 50ml of the bacterial liquid was collected by centrifugation and resuspended in 8ml of guanidine hydrochloride lysate (6M guanidine hydrochloride, 20mM sodium phosphate pH 7.8, 500mM sodium chloride). After centrifugation for 10 min, the supernatant was added to Ni-NTA resin pretreated with denaturing binding buffer (8M urea, 200mM PBS pH 7.8, 500mM sodium chloride). Incubate at room temperature for 30min, wash the binding column twice with 4ml of denatu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a diagnostic kit for tuberculosis and mycobacterium tuberculosis infectors, a preparation method and an application method thereof. By using the linker for encoding 15 amino acid (G4S1) 3, the encoding genes (SEQ.ID.NO.6) of a mycobacterium tuberculosis specific antigen Rv3875 and Rv3874 are connected in series, and then inserted into an E. coli expression vector, and the high-efficiency expression and purification for the fusion protein of Rv3875 and Rv3874 in the E. coli are achieved. The recombinant protein at least comprises 8 T cell epipositions which can be used for cell immunity diagnosis, and a diagnostic kit and diagnostic method for a whole blood IFN-Gamma release analysis method are established by taking the protein as the basis and combining the human IFN-Gamma enzyme-linked immunoassay technology, and can be used for the early, specific diagnosis and screening of tuberculosis and mycobacterium tuberculosis infectors.

Description

technical field [0001] The invention relates to a rapid, early and specific detection method for tuberculosis patients and tuberculosis-infected patients, in particular to a tuberculosis antigen-specific whole blood IFN-γ diagnostic kit and its production and application methods. Background technique [0002] Tuberculosis is one of the important infectious diseases that are mainly transmitted through the respiratory tract and seriously endanger my country and the world. According to the estimates of the World Health Organization, there are more than 1 / 3 of people infected with Mycobacterium tuberculosis in the world, and 10% of them can develop into tuberculosis patients in their lifetime. Therefore, the screening of infected persons plays an extremely important role in the prevention and control of tuberculosis and even its ultimate elimination [CDC.MMWR 44(1995)1-17.]. [0003] Existing diagnostic techniques are very difficult for the diagnosis of Mycobacterium tuberculos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/50G01N33/569
Inventor 范雄林
Owner 范雄林
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More