Hsa-mir-210 kit and detection method for detection of pregnancy-induced hypertension syndrome
A technology of hsa-mir-210 and gestational hypertension, applied in the field of medical biological detection, can solve the problem of no has-mir-210 and the like, and achieve the effect of reducing the occurrence of gestational hypertension and its related complications
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1: prepare test kit of the present invention (for one person's use)
[0035] The kit of the present invention consists of the following:
[0036] 1. 1 tube of reverse transcription primer, 100 μl / tube Concentration: 10 μM The reverse transcription primer is:
[0037] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGCCGCT
[0038]2. One tube of upstream and downstream primers for Real-time PCR, 100 μl / tube Concentration: 10 μM;
[0039] The upstream primer is: ACGATGCTGTGCGTGTGAC
[0040] The downstream primer is: GTGCAGGGTCCGAGGT
[0041] 3.Trizol reagent 1 tube 2000μl / tube
[0042] 4. Chloroform 1 tube 500ul / tube
[0043] 5. Absolute ethanol 1 tube 7ml / tube
[0044] 6. DEPC H 2 O 1 tube 1000μl / tube
[0045] 7. dd H 2 O 1 tube 2000μl / tube.
[0046] The present invention finds the mature body sequence CUGUGCGUGUGACAGCGGCUGA of hsa-mir-210 according to the known bioinformatics, and its specific reverse transcription primers and the upstream and downstr...
Embodiment 2
[0058] Embodiment 2: the detection of kit of the present invention
[0059] 1. Collection of plasma samples and sample preparation:
[0060] Because plasma has the advantages of convenient sampling, non-invasiveness, and continuous detection, the detection of biomarkers of pregnancy-induced hypertension from plasma can improve the detection technology of pregnancy-induced hypertension to a new level, so as to achieve early prevention, purpose of early treatment.
[0061] Plasma samples were collected in the Department of Obstetrics and Gynecology of Shanghai Changhai Hospital and the Department of Obstetrics and Gynecology of the First Affiliated Hospital of Anhui Medical University, and were divided into the following four groups: (1) pregnant women with hypertensive pregnancy (n=10); (2) mild premonition Pregnant women with epilepsy (n=10); (3) pregnant women with severe preeclampsia (n=10); (4) healthy pregnant women as a control group (n=10). The difference between the g...
Embodiment 3
[0085] Example 3: Comparison of mir-210 content in plasma between healthy pregnant women and pregnant women with pregnancy-induced hypertension
[0086] Comparing the has-mir-210 in the plasma of all pregnant women with pregnancy-induced hypertension with the has-mir-210 in the plasma of healthy pregnant women, using the t test, the result is Pfigure 1 )
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com