Unlock instant, AI-driven research and patent intelligence for your innovation.

Human recombination Reg4 protein and coding gene thereof as well as preparation method thereof

A technology of human recombination and protein, applied in the field of genetic engineering, can solve the problems of difficult purification and low content, and achieve the effect of low cost, high activity and simple process

Inactive Publication Date: 2010-02-17
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Reg4 has very little content in organisms and is difficult to purify
At present, there is no report or market of human recombinant Reg4 protein with biological activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human recombination Reg4 protein and coding gene thereof as well as preparation method thereof
  • Human recombination Reg4 protein and coding gene thereof as well as preparation method thereof
  • Human recombination Reg4 protein and coding gene thereof as well as preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0059] Step 1, construction of human recombinant Reg4 protein expression vector

[0060] Primer 5'GGAATTC from human liver cDNA CATATG GATATCATCATGAGACCCAGC 3' (SEQ ID NO: 4) and reverse primer 5'CG GGATCC CTATGGTCGGTACTTGCACAGG 3' (SEQ ID NO: 5) (synthesized by Shanghai Sangon) PCR produced human Reg4 gene. The parts underlined in the primers are the restriction sites of NdeI and BamH I. The PCR conditions are: 94°C for 2 minutes: 94°C for 30 seconds, 58°C for 30 seconds, 68°C for 30 seconds, 35 cycles. PCR product gel electrophoresis, recovery of DNA fragments of about 500bp (see figure 1 ), digested with Nde I and BamH and packaged the fragments cut into Nde I and BamH double digested pET30a plasmid and sequenced (Invitrogene). Positive clones were selected with a karimycin plate, and plasmids were extracted from the positive clones, and the correctly packaged plasmid (SEQ ID NO: 2) was verified by Nde I and BamH double enzyme digestion and sequencing. figure 1 It is...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a human recombination Reg4 protein and a coding gene thereof as well as a preparation method thereof, belonging to the technical field of gene engineering. The invention relates to a human recombination Reg4 protein which is the protein of (a) or (b) as follows: (a) a protein shown as an amino acid sequence, such as SEQ ID NO: 1; and (b) a protein which is formed by substituting, deleting one or more amino acids from or adding one or more amino acids to the amino acid sequence in (a), has the added value promoting activity of a cancer cell and is derived from the (a). The invention also relates to a DNA sequence for coding the human recombination Reg4 protein. The invention also provides a method for preparing the human recombination Reg4 protein, which comprises the following steps: constructing a recombination expression vector containing DNA for coding the human recombination Reg4 protein; preparing a transformant containing the recombination expression vector obtained in the step (1); culturing the transformant and expressing the protein; purifying the protein and obtaining the human recombination Reg4 protein. The human recombination Reg4 protein is ina way of directly having activity and has simple preparation method, low cost, protein product purity more than 98 percent, low endotoxin content and high activity.

Description

technical field [0001] The invention relates to a human recombinant Reg4 protein, its coding gene and a preparation method of the protein, belonging to the technical field of genetic engineering. Background technique [0002] Reg4 protein can promote the proliferation and growth of several tumor cells, and its expression is significantly increased in colon cancer, gastric cancer, pancreatic cancer and prostate cancer, as well as inflammatory bowel disease. The human Reg4 gene (NM_032044.2) is 1285bp in length, and the length of CDS is 477bp. The 66 bp in front of CDS encodes a signal peptide with a length of 22 amino acids. The signal peptide is not included in secreted Reg4. However, Reg4 is rarely present in organisms and is difficult to purify. At present, there is no report or market of human recombinant Reg4 protein with biological activity. Our laboratory has developed a method of directly expressing and purifying the mature form of human recombinant Reg4 in E. col...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/63C12N15/70C12P21/02C07K1/18C12R1/19
Inventor 韩伟胡国勇
Owner SHANGHAI JIAO TONG UNIV