Primer for detecting dynamic mutation of CAG repetitive sequence of ATXN3 gene and PCR amplification method thereof

A repeat sequence and dynamic technology, applied in the field of biomedicine, can solve the problem of low specificity of ATXN3 gene CAG repeat sequence, and achieve the effect of high PCR efficiency and sensitivity, simple operation and high specificity

Inactive Publication Date: 2011-07-27
SUZHOU UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The invention provides a primer for detecting the dynamic mutation of the ATXN3 gene CAG repeat sequence and a PCR amplification method thereof, and aims to solve the problem of low specificity of the existing PCR amplification of the ATXN3 gene CAG repeat sequence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for detecting dynamic mutation of CAG repetitive sequence of ATXN3 gene and PCR amplification method thereof
  • Primer for detecting dynamic mutation of CAG repetitive sequence of ATXN3 gene and PCR amplification method thereof
  • Primer for detecting dynamic mutation of CAG repetitive sequence of ATXN3 gene and PCR amplification method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: A primer for detecting the dynamic mutation of the CAG repeat sequence of the spinocerebellar ataxia ATXN3 gene, using the following pair of primers (5'→3'):

[0039] Forward primer: CCAGTGACTACTTTGATTCG;

[0040] Reverse primer: CATGATGAATGGTGAGCAGG.

[0041] In this embodiment, the dynamic mutation of the CAG repeat sequence of the ATXN3 gene in spinocerebellar ataxia can be detected by the above pair of primers.

Embodiment 2

[0042] Embodiment 2: A PCR amplification method for detecting the dynamic mutation of the CAG repeat sequence of the spinocerebellar ataxia ATXN3 gene, comprising the following steps:

[0043] Step 1: Prepare DNA

[0044] (1) Blood samples are drawn from the human body.

[0045] (2) Obtaining DNA from blood samples, that is, preparation of genomic DNA samples of leukocytes in blood samples.

[0046] Reagent preparation:

[0047] Anticoagulant: Each 100ml anticoagulant contains 0.48g citric acid, 1.32g sodium citrate, and 1.47g glucose.

[0048] Red blood cell lysate: 10mmol / L Tris-HCl, pH 7.6;

[0049] 5mmol / L MgCl 2 ;

[0050] 10mmol / L NaCl;

[0051] White blood cell lysate: 10mmol / L Tris-HCl, pH 7.6;

[0052] 10mmol / L EDTA (pH 8.0)

[0053] 50mmol / L NaCl

[0054] 10mg / ml proteinase K (Protease K): 10mg Protease K dissolved in 1ml ddH 2 O (double distilled water), aliquoted and stored at -20°C. When in use, melt at 4°C.

[0055] Procedure for obtaining DNA from a bl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an improved primer for detecting the dynamic mutation of a CAG repetitive sequence of a spinocerebellar ataxia ATXN3 gene and a method thereof, characterized in that a specially designed specific primer is adopted to amplify the amount of a DNA fragment containing the CAG repetitive sequence in the ATXN3 gene to the observable degree through a special PCR procedure, and gel electrophoresis is utilized to observe the size of a PCR amplification product fragment and estimate the number of replication of the CAG dynamic mutation in the ATXN3 gene. The invention has the advantages that: 1. simplicity and economy, and no sequence detection, i.e. the method can be operated in common molecular biology laboratories or control laboratories, thereby establishing a simple detection method of the amplification CAG repetitive sequence; 2. high sensitivity and reliability: 25ng genome DNA is enough to detect the number of replication of the CAG dynamic mutation in the ATXN3gene, thereby a reliable basis is provided for clinically diagnosing spinocerebellar ataxia.

Description

technical field [0001] The invention belongs to the clinical detection technology in the field of biomedicine, and specifically relates to a new primer and PCR amplification method for detecting the dynamic mutation of the ATXN3 gene CAG repeat sequence of spinocerebellar ataxia, and the detection result can be used for clinical auxiliary diagnosis of spinocerebellar ataxia. financial disorder. Background technique [0002] Spinocerebellar Ataxia (SCA) is a group of chronic degenerative diseases of the central nervous system characterized by progressive balance and coordination disorders, previously known as Autosomal Dominant Cerebellar Ataxias, ADCAs). The main lesion sites of spinocerebellar ataxia are the spinal cord, cerebellum, and brainstem, and other tissues such as spinal nerves, cranial nerves, sympathetic nerves, basal ganglia, thalamus, hypothalamus, and cerebral cortex can be involved, and can also be accompanied by other systemic abnormalities. Such as skelet...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor秦正红方琪何晓辉
OwnerSUZHOU UNIV