Oligonucleotide chip capable of detecting five enteroviruses simultaneously and application thereof

An enterovirus and oligonucleotide technology, applied to the detection of human pathogenic enteropathogen viruses in the marine environment, in the field of oligonucleotide chips, to achieve the effect of high specificity and wide application prospects

Inactive Publication Date: 2010-02-24
SHANDONG MEDICAL BIO TECH RES CENT +1
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the search of the prior art, it has not been found that the target genes of various viruses that can cause human diarrhea in the marine environment are simultaneously amplified by using multiple primer PCR methods, and Tamara is used to mark the downstream primers to achieve multiple Application of Parallel Detection of Human Pathogenic Enteroviruses in Marine Environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligonucleotide chip capable of detecting five enteroviruses simultaneously and application thereof
  • Oligonucleotide chip capable of detecting five enteroviruses simultaneously and application thereof
  • Oligonucleotide chip capable of detecting five enteroviruses simultaneously and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1 Oligonucleotide chip preparation and hybridization method of downstream primer Tamara labeling multiplex PCR amplification labeling method

[0039] 1. Design and synthesis of probes

[0040] Using the probe design software ArrayDesigner4.2, five virus-specific probes were designed, and one positive control probe (PC) and one negative control probe (NC) were designed at the same time. The sequences are as follows:

[0041] HAV-P: NH2-(CH2)6-Pol(dT)15-TTAAAGATCCACAGTATCCAGTTTGGGAATTAACAAATCAGAGTTTGGTCAGAGCTGAACATTGGAACAG;

[0042] ROV-P: (NH2-(CH2)6-Pol(dT)15-TTATGTCTGTATTATTCCAACTGAAGCAAGTACTCAAATCAATGATGGTGACTGG;

[0043] NOV-P: NH2-(CH2)6-Pol(dT)15-GGTAGCAGAAGACCTTCTTTCTCTAGCGTGGTGGATGTGGGTGACTTCACAATATCAATCAACGAG;

[0044] ASV-P: NH2-(CH2)6-Pol(dT)15-GAATTCGTTGTCATAAAACCAGGTGCATTATGTGTTATAGACACCCCTGAAGGAAAAGGGACAGGTT;

[0045] ADV-P: NH2-(CH2)6-Pol(dT)15-CTACTTCGTATATTCTGGATCTATTCCCTACCTGGATGGCACCTTCTACCTTAACCACACTTTCAAG;

[0046] PC: NH2-(CH2)6-Poly(dT...

Embodiment 2

[0056] The optimization of embodiment 2 chip preparation conditions

[0057] 1.1 Optimization of probe spotting concentration Select ASV standard strain for DNA amplification labeling, use aldehydized glass slide as substrate, use Pixy5500 spotting instrument with SMP2 spotting needle to spot samples at different concentrations, and the spotting concentration is 50 μmol / L, 30μmol / L, 10μmol / L, 5μmol / L, a total of 4 gradients, choose the spotting concentration with the best hybridization effect.

[0058] After 3 repeated experiments, it was shown that when the probe concentration was 10 μmol / L, the fluorescence intensity had reached a clear hybridization signal visible to the naked eye.

[0059] 1.2 Optimization of UV cross-linking ASV standard strains were selected for DNA amplification and labeling. Aldehydized glass slides were used as substrates. The energy of UV cross-linking was selected to be 1200mJ, 2400mJ and 3600mJ respectively, and the cross-linking energy with the b...

Embodiment 3

[0070] Example 3. Detection results of five kinds of long-fragment oligonucleotide chips of viruses on marine environmental specimens

[0071] The oligonucleotide chip labeled with downstream primer Tamara and multiplex PCR amplification of the present invention was used to detect five kinds of enteric pathogens in marine shellfish samples. The method is as in Example 1, and the results are shown in Table 1.

[0072] Table 1: Detection results of five enteric pathogens in marine shellfish samples

[0073]

[0074] a) Kappa > 0.75, consistency is satisfactory; b) p > 0.05, no significance

[0075] The result shows: compared with the detection result of the oligonucleotide chip of the present invention and the PCR detection method, there is no significant difference in the result, and the two have a higher coincidence rate. However, compared with PCR, it has higher detection specificity and is suitable for marine environment and seafood detection.

[0076] In summary, the o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an oligonucleotide chip capable of detecting five enteroviruses simultaneously and an application thereof. The chip comprises a substrate, probes of pathogens of five enteroviruses coated on the substrate, negative contrast, positive contrast and blank contrast, wherein the probes of pathogens are five 54-70mer of HAV-P, ROV-P, NOV-P, ASV-P and ADV-PV1 probes. The chip of the invention adopts multiple PCR to amplify a plurality of target sequences of pathogens simultaneously and uses the downstream primer Tamara labeling method to perform fluorescence labeling to PCR product, the labeled PCR product is hybridized with the chip to realize the accurate detection of pathogens, the detection sensitivity is equal to that of PCR and the specificity is high. The detectionefficiency and accuracy are obviously shortened. The technology system of the invention is applicable to fields such as sea water and marine life specimens monitoring, food hygiene surveillance, customs quarantine, related clinical detection and the like.

Description

technical field [0001] The invention relates to an oligonucleotide chip and its application, in particular to an oligonucleotide chip capable of simultaneously detecting five common enteroviruses in the marine environment based on downstream primer Tamara markers and multiplex PCR amplification and its application in the detection of marine environment The application in human pathogenic enteropathogenic virus belongs to the technical field of biochip and environmental microorganism monitoring. Background technique [0002] With the population growth of my country's coastal cities, the discharge of urban domestic sewage has increased year by year, resulting in more and more human pathogenic viruses entering the marine environment. Many virus particles have a strong tolerance in the marine environment, and can infect people by polluting seafood, recreational water, etc., and then trigger the outbreak of infectious diseases. Therefore, the research and development of a rapid ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C40B40/06C12R1/93
CPCY02A50/30
Inventor高雪芹岳龙涛樊景凤韩金祥
OwnerSHANDONG MEDICAL BIO TECH RES CENT