Cotton flowering hormone GhFT and vector, construct, cell and polypeptide thereof
A florigen and gene technology, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve the problems of FT homologous gene cloning and functional research in cotton that have not been reported
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1: Cloning and Analysis of GhFT Gene CDS
[0037] According to the published amino acid sequence of the flowering locus T gene FT (Flowering locus T) in the Columbia (Col) ecotype Arabidopsis thaliana, the accession number is AAF03926.1, in GenBanK (www.ncbi.nlm.nih.gov) Download the sequence, use the sequence as a probe (query), select the cotton ESTs database, run the tBlastx program, and search for a cotton homologous ESTs sequence, the accession number is UFL_438_68 (ES826802).
[0038] According to the nucleotide sequence of the EST sequence, design primers: Kpn I-GhFT-F: GGGGTACC ATGCCTAGAGACAGAGATCCTTTGGT, see SEQ ID NO: 3; XbaI-GhFT-R: GCTCTAGA TCATGTCCTACGGCCACCGGATCCACT, see SEQ ID NO: 4 (the underlined part is Kpn I and Xba I restriction site). Using the cDNA of the leaves of Xinluzao 33, an upland cotton variety in Xinjiang, as a template, amplify by RT-PCR, connect the amplified output to pGEMT-easy (promega), construct pGEMT::GhFT, and transfor...
Embodiment 2
[0041] Example 2: Tissue expression analysis of GhFT gene
[0042] (1) Experimental method
[0043] The roots, hypocotyls, flowers, true leaves, fibers, and ovules of Xinluzao 33 were collected and quick-frozen in liquid nitrogen, and the total RNA was extracted by the CTAB method. Transfer to CTAB extraction buffer (2% CTAB, 2% polyvinylpyrrolidone PVP, 100mmol / L Tris-HCl, 25mmol / L EDTA, 2.0mol / L NaCl, 2% mercapto ethanol), mix well and then 65°C water bath for 10min, shake 2-3 times during this period; 2) 4°C, 12000rpm / min, 10min; 3) Slowly absorb the supernatant, add an equal volume of phenol:chloroform:isoamyl Alcohol = 25:24:1 extraction once, shake vigorously and place at room temperature for 5 minutes; 4) 4°C, 12000rpm / min, 10 minutes; 5) Slowly absorb the supernatant, add an equal volume of chloroform for extraction twice, fully shake each time , and placed at room temperature for 5min; 6) 4°C, 12000rpm / min, 10min; 7) Take the supernatant, add 1 / 3 volume of 8mol / L Li...
Embodiment 3
[0046] Example 3: Gene Transformation
[0047] Through genetic transformation in Arabidopsis thaliana, the regulatory effect of cotton GhFT gene on plant flowering was studied.
[0048] 1. Experimental method
[0049] (1) Construction of the carrier
[0050] p35S::GhFT vector: The correctly sequenced plasmid pGEM T::GhFT was digested with Kpn I and Xba I, and the recovered fragment was connected to the plasmid pCAMBIA2300 that had been digested with the same double enzymes to construct the vector: p35S::GhFT.
[0051] p35S::GhFT-GFP vector: first use primers 5'- GGGGTACC ATGCCTAGAGACAGAGATCCTTTGGT-3' (see SEQ ID NO: 7) and 5'- TCTAGA TGTCCTACGGCCACCGGATCCACT-3' (see SEQ ID NO: 8) (the underlined parts are BamH I and Xba I restriction sites respectively), use pGEM T::GhFT plasmid DNA as a template to amplify the CDS region of the GhFT gene, and connect it to the vector pGEM Teasy (promega), after the correct sequence of the plasmid, it was digested by BamH I and Xba I, an...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com