Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for analyzing exogenous gene flow risk of human antithrombinIII transgenic sheep

A technology of transgenic sheep and antithrombin, applied in the field of analysis of risk of exogenous gene drift, can solve problems that have not been taken seriously, and achieve high detection specificity

Active Publication Date: 2012-01-18
青岛森淼生物技术有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The ecological and environmental safety issues that may be caused by gene drift in transgenic plants have attracted widespread attention, but the possibility of gene drift in transgenic animals has not been taken seriously

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for analyzing exogenous gene flow risk of human antithrombinIII transgenic sheep
  • Method for analyzing exogenous gene flow risk of human antithrombinIII transgenic sheep
  • Method for analyzing exogenous gene flow risk of human antithrombinIII transgenic sheep

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1 Design of primers and Taqman probes

[0073] The sequence of human ATIII gene (NM_000488) was analyzed by Primer 5.0 software, and human ATIII-specific primers (F: 5'-gtgataggaactgtaacct-3'; R: 5'-cggccagcaatcacaacag-3') used to construct standard plasmids were designed and synthesized.

[0074] Taqman probes and primers were designed using Primer Express 3.0 software from Applied Biosystems (F: 5'-TGTGATAGGAACTGTAACCTCTGG-3'; R: 5'-GCTTGGCTGTGCAGATGTC-3'; Taqman probe: 5'-(FAM)TGTCCTTGCTGCTCATTGGCTTCTG (Eclipse) -3').

[0075] The specificity of designed primers and probe sequences was analyzed by BLAST online software.

[0076] The primers and probes were synthesized by Dalian Takara Company.

Embodiment 2

[0077] Example 2 Preparation, DNA Amplification and Cloning of Transgenic Sheep Blood Genomic DNA

[0078] 1. Preparation of Genomic DNA from Blood of Transgenic Sheep

[0079] The blood samples were anticoagulated with EDTA, and the blood was stored in a 1.5ml centrifuge tube at 4°C for later use. Blood genome was extracted using QIAGEN Spin Column Blood Genome Extraction Kit.

[0080] 2. Amplification of transgenic sheep ATIII gene

[0081] The blood genome of transgenic ATIII sheep (experiment number A22) was used as a template.

[0082] The PCR amplification system is as follows:

[0083] 25μl system, DNA template 3μl, 10×Ex Taq buffer 2.5μl, dNTP (2.5mM) 2.5μl, primer F (10pM), primer R (10pM), Taq enzyme 0.2μl, ddH 2 O to make up to 25 μl. The reaction conditions were 94°C for 5min; 95°C for 30S, 55°C for 30S, 72°C for 1.5min, 25 cycles; 72°C for 10min. The size of the amplified fragment was 1263bp, and the amplification effect was analyzed by 1% agarose gel electr...

Embodiment 3

[0088] Example 3 Fluorescent quantitative PCR detection and analysis

[0089] 1. Fluorescent quantitative PCR detection

[0090] The 25 μl reaction system includes 12.5 μl of TaqMan Universal PCR Master Mix buffer, 10 ng of blood sample DNA template, the concentration of primers and probes is added according to the specific experiment, and the system uses ddH 2 O (double distilled water) to make up. The specific reaction conditions were two temperature cycle (95°C for 10 min; 95°C for 15 s, 60°C for 1 min, 40 cycle). Optimum usage of primers and probes was screened by matrix method.

[0091] 2. Sensitivity evaluation and quantitative analysis

[0092] The RNA standard product was serially diluted by 1 / 10, and the established detection system was used to perform fluorescent quantitative PCR detection on the RNA standard product of different concentrations to determine the detection sensitivity. At the same time, the standard curve is obtained by detecting the amplification ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for analyzing the exogenous gene flow risk of human antithrombinIII transgenic sheep. The method comprises the following steps: designing a primer and a Taqman probe, preparing blood genome DNA, amplifying ATIII gene, cloning AT111 gene, performing a fluorescent quantitative PCR detection, sensitivity evaluation and quantitative analysis. Aiming at sensitively detecting the micro AT111 gene, a technical method for detecting humanATIII gene by sensitive and specific real time fluorescent quantification PCR can be established by researches, the AT111 gene of 1copy can be detected at least, and the detected specificity is high. A primary research on security assessment of environment of antithrombinIII transgenic sheep is developed on the basis. The detection works (57 samples in total) of AT111 gene in homologous and heterologous animal blood genome which is closely contacted with ATIII transgenic sheep are completed. The results show that humanATIII genedose not flow between the transgenic sheep and non-transgenic sheep or other animals, and prompts that the transgenic sheep is safe to the environment.

Description

technical field [0001] The invention belongs to the field of detection and evaluation of the environmental safety of transgenic animals, and in particular relates to an analysis method for exogenous gene drift risk of human antithrombin III transgenic sheep. Background technique [0002] With the rapid development of biotechnology, the research on transgenic animals has been deepened and accelerated, and transgenic breeding has become an important way to cultivate new varieties. While commercial transgenic animals are about to appear, the potential safety problems associated with transgenics have aroused the attention of countries all over the world. attention and attention [1-2] . Transgenic animals are genetically engineered organisms in which biological genetic information has been transferred, replaced, fused and expressed through genetic engineering technology. Due to the insertion of foreign genes, the original breeding rules have been broken, and the situation of spe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 袁三平顾玉超邹贤刚赵雅琳
Owner 青岛森淼生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com