Anti-CLCN7 protein monoclonal antibody and application for same

A monoclonal antibody and antibody technology, applied in the field of biomedicine, can solve problems such as retinal degeneration

Inactive Publication Date: 2013-07-03
北京中科非凡生物技术有限公司
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Additionally, CLC-7-deficient mice display severe retinal degeneration

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-CLCN7 protein monoclonal antibody and application for same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Embodiment one, human source CLCN7 protein Recombinant expression and purification

[0056] Design primers (Primer 1: 5′GCATGCCATGGCCAACGTCTCTAAG

[0057] and Primer2: 5′GTTCCTCGAGTTAGCGCTTGATCTCCACC

[0058] ) was amplified by PCR from human skeletal muscle cell cDNA (PCR main reaction conditions: denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 35 seconds; a total of 30 cycles), and the obtained target fragment was subjected to NcoI / XhoI After double enzyme digestion, it was connected to the NcoI / XhoI site of the expression vector pHAT2. After screening the positive clones, the obtained sequence was found to be completely consistent with the theoretical sequence after sequencing:

[0059] atggccaacgtctctaagaaggtgtcctggtccggccgggaccgggacgacgaggaggcggcgccg

[0060] ctgctgcggaggacggcgcggcccggcggggggacgccgctgctgaacggggctgggcctggggctgcg

[0061] cgccagtcaccacgttctgcgcttttccgagtcggacatatgagcagcgtggagctggatgatgaacttttggacc ...

Embodiment 2

[0070] Embodiment two, Panning screening

[0071]The phage surface display library is a non-immune murine ScFv expression library previously constructed by the patent applicant. This patent is to screen antibodies that can specifically recognize CLCN7 protein from this library. After coating the plastic culture dish with CLCN7 protein antigen, the supernatant of the recombinant phage was poured on it, cultured at 37°C for 2 hours, and the plate was washed 20 times with PBS and PBST successively. Then, the TG1 cultured to the logarithmic growth phase was poured onto the immunoadsorbed petri dish, and incubated at 37° C. for 1 hour. Such a process of "adsorption-elution-propagation" is Panning screening, and superinfection with M13K07 can generate a phage surface display library enriched in clones. Thereafter, 7 rounds of screening were carried out as described above.

Embodiment 3

[0072] Example 3. Identification of antigen-binding activity of a single recombinant phage clone

[0073] 1. Preparation of monoclonal recombinant phage

[0074] After Panning screening, the TGI bacterial solution was diluted according to the stock solution; 1:10; 1:100; 1:10004 dilutions, spread on SOBAG agar plates, and cultured overnight at 30°C. Pick 90 single colonies, inoculate them in 100ul of 2×YTAG respectively, culture overnight at 30°C, take 20ul of the culture, add it to 200ul of 2×YTAG containing 5×10pfu / ml M13K07, culture with shaking at 37°C for 2h, centrifuge, and use Resuspend the pellet in 200ul of 2×YTAK and incubate overnight at 30°C. The supernatant after centrifugation is a single recombinant phage.

[0075] 2. ELISA detection of antigen binding activity (Douillard, et al., Enzyme-linked Immunosorbent Assay for Screening monoclonal antibody production using enzyme-labeled second antibody, Meth.Enzymol,. 92:168-74, 1983)

[0076] Set up 1 negative cont...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a monoclonal antibody capable of specifically identifying CLCN7 protein and the function thereof in treatment for bone diseases and tooth diseases. The monoclonal antibody is good in stability and strong in specificity. The invention provides a variable region sequence of the antibody. The invention further provides a medicine composition.

Description

technical field [0001] The present invention belongs to the technical field of biomedicine. Specifically, the present invention provides a monoclonal antibody that can specifically recognize ClCN7 protein; and the application of the antibody in the preparation of medicines for treating various bone and dental diseases. The invention also provides a pharmaceutical composition comprising the monoclonal antibody as an active ingredient. Background technique [0002] Antibodies have been developed for hundreds of years as preparations for disease prevention, diagnosis and treatment. With the development and improvement of genetic engineering antibody technology, antibody drugs have developed from mouse monoclonal antibodies to human-mouse chimeric antibodies, humanized antibodies and human antibodies. As of 2010, the US FDA has approved more than 40 antibody drugs. In addition, more than 120 antibody drugs are in clinical research, and more than 500 antibody drugs are in precl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/18C07K16/46A61K39/395A61P1/02A61P19/08
Inventor 安祺
Owner 北京中科非凡生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap