Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

5-enolpyruvyl-shikimate-3-phosphate (EPSP) synthase gene from ochrobactrum anthropi and application thereof

A gene and protein technology, applied in the field of EPSP synthase gene and its application in transgenic plants, can solve the problems that there are no reports of glyphosate-resistant gene crops entering the commercialization stage.

Active Publication Date: 2014-11-05
BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] my country has made some progress in the research of transgenic glyphosate-resistant crops, but there is no report on the commercialization of transgenic glyphosate-resistant crops

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 5-enolpyruvyl-shikimate-3-phosphate (EPSP) synthase gene from ochrobactrum anthropi and application thereof
  • 5-enolpyruvyl-shikimate-3-phosphate (EPSP) synthase gene from ochrobactrum anthropi and application thereof
  • 5-enolpyruvyl-shikimate-3-phosphate (EPSP) synthase gene from ochrobactrum anthropi and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1 Glyphosate-resistant strain-Bacillus pallidus Ochrobactrum anthropi Isolation, purification and identification of KT-CGL-7-7

[0061] 1. Source of soil samples

[0062] Soil samples were collected from 5 cm below the soil layer of the experimental fields sprayed with glyphosate.

[0063] 2. Isolation and purification of glyphosate-resistant strains

[0064] Enrichment of bacterial strains: Weigh 20 grams of soil samples respectively, one of which is added to 1 / 10LB liquid medium containing 100mg / L glyphosate (filling volume is 50ml / 300ml Erlenmeyer flask), the other Soil samples were added to the 1780 modified liquid medium containing 100mg / L glyphosate (the filling volume was 50ml / 300ml Erlenmeyer flask), placed in 30 o The enrichment culture was carried out in a C shaker at 200 rpm.

[0065] Acclimatization and purification of strains: Each time of enrichment culture for 7 days, the culture was centrifuged at 3000rpm for 10min, the supernatant was disca...

Embodiment 2

[0071] Example 2 Cloning of DNA fragments highly tolerant to glyphosate

[0072] 1. PCR method to obtain some DNA fragments with high tolerance to glyphosate

[0073] According to the published in NCBI Ochrobactrum anthropi Sequence Design of EPSP Synthase Gene

[0074] Primer 1-F (sequence shown in SEQ ID No: 3): 5′-ATGCAGGCCATGGGTGCCAGGATT-3′

[0075] Primer 1-R (sequence shown in SEQ ID No: 4): 5′-GCGATGCGGTGGTCGAGGTGGGTT-3′

[0076] According to the published in NCBI Brucella melitensis Sequence Design of EPSP Synthase Gene

[0077] Primer 2-F (sequence shown in SEQ ID No: 5): 5′-CGGGATCC ATGTCCCATTCCGCATGCCCG-3′

[0078] Primer 2-R (sequence shown in SEQ ID No: 6): 5'- CCGCTCGAGCGACATTCTGCACCGCTTTCGGCAAT-3'

[0079] according to O. anthropi and B. melitensis Designing primers for homologous sequences of the EPSP synthase gene

[0080] Primer 3-F (sequence shown in SEQ ID No: 7): 5′-GATGCCTCGCTTTCCAAGCGCC-3′

[0081] Primer 3-R (sequence shown in SEQ ID N...

Embodiment 3

[0094] Example 3 Construction of Plant Expression Vector PTG2-OEPS

[0095] According to the O-EPSP synthase gene sequence, design primers 7-F and 7-R

[0096] Primer 7-F (sequence shown in SEQ ID No: 15): ACATGTATGTCCCATTCCGCATGC

[0097] Primer 7-R (sequence shown in SEQ ID No: 16): CCCGGGTCATTCTGCTGCGCCCG

[0098] The O-EPSP synthase gene sequence was amplified by PCR with primers 7-F and 7-R, and then digested with Pci Ⅰ and Xma Ⅰ to obtain an insert fragment; the PTG1 vector taken from the company was digested with Pci Ⅰ and Xma Ⅰ, Then use ligase to connect the above-mentioned insert fragment and vector, transform the ligated product into E. coli DH5α strain, select positive clones after culturing and screening in 2×YT medium containing 50 mg / L kanamycin, extract the plasmid and select the correct sequence by sequencing The clone obtained was a plasmid with the target gene, named PTG2-OEPS, see attached figure 1 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a 5-enolpyruvyl-shikimate-3-phosphate (EPSP) synthase gene from ochrobactrum anthropi and application thereof. The invention also provides genetic engineering intermediates (such as an expression cassette, a carrier and a cell) of the gene, a method for obtaining a plant with glyphosate resistance, and application of the method, and provides an identification method for judging whether the plant has the glyphosate resistance. The EPSP synthase gene plays an important role in research and development of the glyphosate-resistant plant.

Description

Technical field [0001] The invention belongs to the field of microbial genetic engineering and the field of plant genetic engineering. It involves an EPSP enzyme gene that is derived from the pale bacteria and its application in genetically modified plants. Background technique [0002] Glyphosate (Glyphosate) is an organic phosphorus herbicide.In the early 1970s, it was developed by Mengshan Metropolis. It is usually made into isopropyne salt or sodium salt when used.Its isopropyne salt is the active ingredient of the famous herbicide trademark "Roundup". [0003] Greening oligosuity is an excellent herbicide of the broad -spectrum, an internal absorbing and conducting guide, and is one of the largest herbicides in the world.The grass and glyphosate has excellent weeding. It is easily absorbed and transmitted by plant leaves to the whole body of the plant, which is very active in annual and perennial weeds.But this herbicide is a non -selective herbicide, which is also lethal fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/63C12N1/21C12N1/19C12N5/10C12N15/84A01H5/00C12Q1/68C12Q1/48C12R1/01
Inventor 夏勉李毅徐海英徐沫文张斌何峰郑辰
Owner BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com