Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A double recombinant protein of Aeromonas hydrophila and Edwardsiella tarda and its preparation method

A technology of Aeromonas hydrophila and recombinant protein, which is applied in chemical instruments and methods, biochemical equipment and methods, recombinant DNA technology, etc. Reduce the damage of fish body and improve the effect of immune effect

Active Publication Date: 2015-08-12
JIMEI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Recently, there have been researches on inactivated vaccines and subunit vaccines of Aeromonas hydrophila and Edwardsiella tarda, but to apply these research results to immunize eels to prevent the invasion of various pathogens, it is necessary to carry out multiple studies on eels. One-time injection operation will cause great harm to the fish body, and the operation is cumbersome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A double recombinant protein of Aeromonas hydrophila and Edwardsiella tarda and its preparation method
  • A double recombinant protein of Aeromonas hydrophila and Edwardsiella tarda and its preparation method
  • A double recombinant protein of Aeromonas hydrophila and Edwardsiella tarda and its preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] In this example, the dual recombinant protein of Aeromonas hydrophila and Edwardsiella tarda of the present invention was carried out. Preparation of (OMP-Arom-Edwa)

[0041] (1) Use the following specific primers to amplify the nucleotide sequence of the outer portion of the type II porin of Aeromonas hydrophila: forward primer B11F:

[0042] 5'tcgggcggtggcggctcgggtggcggatcatccggtatcgccaagactgaatg3' (SEQ ID NO3) and reverse primer B11R: 5'CCGGAATTCctggatcttgtactcggtgtaggc3' (SEQ ID NO4), where B11F includes the linker region (tcgggcggtggcggctcgggtggcggatca), and B11R includes the base cleavage site of ECC and EcoR The nucleotide sequence of the extramembrane portion of ompS2 of Edwardsiella tarda was amplified with the following specific primers: forward primer B79F:

[0043] CGCGGATCCgccggcctgaagtatggcaa (SEQ ID NO5) and reverse primer B79R: acccgagccaccaccgcccgagcctataagcacgggtgaagtcattctcatc (SEQ ID NO6), wherein B79F includes a BamH I restriction site and a protec...

Embodiment 2

[0062] (1) PBS blank control, double inactivated bacterial liquid of Aeromonas hydrophila and Edwardsiella tarda, and the dual recombinant protein of Aeromonas hydrophila and Edwardsiella tarda of the present invention obtained in Example 1 Three groups of eels were immunized by intraperitoneal injection, and each group of eels corresponded to the PBS control group 1, the double inactivated bacteria immunization group 2 and the double-expressed outer membrane protein immunization group 3, wherein the eel hydrophile of the present invention Bacillus and Edwardsiella tarda double recombinant protein was prepared with 0.01M PBS (pH=7.4) to make 1mg / mL before the test, and it was fully mixed with the same amount of Freund's incomplete adjuvant, and the final concentration was 0.5 mg / mL; Aeromonas hydrophila and Edwardsiella tarda were cultured in tryptone soy broth (TSB) at 28°C and 32°C for 24h, respectively, and mixed with 0.01M PBS (pH=7.4) to prepare 5.0× 10 8 cfu / mL bacteria...

Embodiment 3

[0065] (1) Same as embodiment 2;

[0066] (2) After the above three groups of eels were immunized, the serum was collected for ELISA detection of eel serum-specific antibody titer (according to Guo SL, Chen NH, Guan RZ, Feng JJ, Huang WS.2006. Effects of Anti-Bursin Monoclonal Antibody on Immunosuppression in the duck (Cherry Valley duck). Poult Sci, 2006; 85:258-65. carry out), such as image 3 As shown, the antibody levels of the double-inactivated bacteria immunization group 2 and the double-expressed outer membrane protein immunization group 3 were significantly (P<0.01) and significantly (P<0.05) higher than those of the PBS control group 1 on the 14th day and 21st day, respectively. On the 28th day, the antibody level of the double-expressed outer membrane protein immunization group 3 was significantly (P<0.01) higher than that of the PBS control group 1, while the double-inactivated bacteria immunization group 2 was significantly (P<0.05) higher than that of the PBS con...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses eel aeromonas hydrophila and edwardsiella tarda bigeminal recombinant protein and a preparation method thereof. The bigeminal recombinant protein disclosed by the invention comprises an aeromonas hydrophila type II pore protein membrane outer part and an edwardsiella tarda ompS2 membrane outer part which are connected together, and the amino acid sequence of the bigeminal recombinant protein is as shown by SEQ ID NO1. According to the preparation method disclosed by the invention, the aeromonas hydrophila type II pore protein membrane outer part and the edwardsiella tarda ompS2 membrane outer part are connected together through a genetic engineering means to construct the bigeminal recombinant protein, and the bigeminal recombinant protein can prevent inflections of aeromonas hydrophila and edwardsiella tarda at the same time after being used for immunizing eels, and has a better immune effect compared with immunization with single outer membrane protein. The bigeminal recombinant protein disclosed by the invention can obtain an immune effect on a variety of pathogenic bacteria through only once injection on a fish body, so that injuries to the fish body are reduced, and immunization steps are simplified; the preparation method of the bigeminal recombinant protein is suitable for industrial production.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a dual recombinant protein of two species of Aeromonas hydrophila and Edwardsiella tarda and a preparation method thereof. Background technique [0002] Over the past 20 years, fulminant sepsis has occurred in freshwater cultured fish in my country, which has brought immeasurable economic losses to the aquaculture industry. Studies have shown that the main pathogenic bacteria of the disease are Aeromonas hydrophila and Edwardsiella tarda. Aeromonas hydrophila (Aeromonas hydrophila) and Edwardsiella tarda (Edwardsiella tarda) are important pathogenic bacteria of eels, which can cause hemorrhagic sepsis, hepatic and renal enlargement, gill rot, tail rot, etc. A highly contagious disease that can occur in cultured American eels, European eels and Japanese eels. The aquaculture industry has used chemical drugs to treat the disease for a long time. Due to drug resistance and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N1/21C12R1/19
Inventor 郭松林关瑞章王玉冯建军林鹏黄文树
Owner JIMEI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com