Recombinant immunodeficiency plasmid and virus and application thereof

An immunodeficiency plasmid and immunodeficiency virus technology, which is applied to recombinant immunodeficiency plasmids and viruses and application fields, can solve the problems of inappropriate embedded genes and sites, single drug target, and inability to comprehensively evaluate the therapeutic effects of multiple drugs. , to achieve the effect of high-efficiency replication

Active Publication Date: 2015-01-07
INST OF LAB ANIMAL SCI CHINESE ACAD OF MEDICAL SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, these chimeric viruses still have certain limitations. The drug targets contained in them are relatively single, and the therapeutic effect of multiple drugs cannot be comprehensively evaluated.
In addition, whether the construction of simian / human chimeric immunodeficiency virus has the ability to infect cells is an important criterion for success. Although the embedded genes and sites are not suitable, although the correct full-length virus plasmid can be constructed at the molecular level, However, after being packaged into a virus, it has no ability to infect, which requires an extremely sophisticated construction strategy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant immunodeficiency plasmid and virus and application thereof
  • Recombinant immunodeficiency plasmid and virus and application thereof
  • Recombinant immunodeficiency plasmid and virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1: construct immunodeficiency plasmid of the present invention

[0045] Through upstream primers (nucleotide sequence shown in SEQ ID No.3) and downstream primers (nucleotide sequence shown in SEQ ID No.4) with Apa I and Nhe I restriction sites respectively, point mutation PCR Apa I and Nhe I restriction sites were respectively introduced at both ends of the nucleotide sequence shown in SEQ ID No.1, and then connected into the T vector;

[0046] F: ATCCTTTAGCGGGCCCCAAATCACTCTTTG (Apa I); R: CATGTGCTAGCCCTCATCCTGTCTACTTGCCACAC (Nhe I).

[0047] Using the half-length plasmid p239SpSp5' at the 5' end of SIVmac239 as a template, two pairs of primers 2982-F and 3736-R (nucleotide sequences shown in SEQ ID No.5-6), 3736 -F and 6307-R (nucleotide sequence shown in SEQ ID No.7-8) amplification, then use the obtained amplified product as template, through primer 2982-OV-F and 6307-OV-R (SEQ ID No. The nucleotide sequence shown in ID No.9-10) amplifies the 3539bp P-1...

Embodiment 2

[0057] Embodiment 2: the massive preparation of described immunodeficiency plasmid

[0058] The immunodeficiency plasmid was transformed into JM109 strain, and after plate culture at 30°C for 18-20 hours, a single colony was picked and inoculated into 5 mL of LB liquid medium containing ampicillin. After shaking at 30°C and 180rpm for 12 to 14 hours, take 1.5mL of bacterial culture solution for small plasmid extraction. After enzyme digestion and identification are correct, inoculate the remaining 3.5mL of bacterial culture solution into 1L of 2×YT liquid containing ampicillin medium. After shaking culture at 30°C and 180rpm for 12 hours, take 1.5mL of bacterial culture solution for small extraction again. After the enzyme digestion and identification are correct, refer to Qiagen’s instructions, and use Endofree Plasmid Giga Kit to prepare a large amount of plasmids from 1L of bacterial solution. . Proceed as follows:

[0059] (1) Centrifuge the bacterial solution at 4°C, 6...

Embodiment 3

[0069] Embodiment 3: the transfection packaging of immunodeficiency plasmid of the present invention

[0070]Use the immunodeficiency plasmid prepared in Example 2 to transfect 293T cells to obtain infectious complete virus particles, use a 6-well plate to culture 293T cells and obtain virus particles, the specific steps are as follows:

[0071] (1) Spread 293T cells into 6-well plates with 10% complete DMEM medium (5×10 5 / well), overnight culture, the cell density reached 70%, the purpose is to culture for a long time.

[0072] (2) Replace each well with 2ml of complete DMEM medium without antibiotics, and continue culturing for 2 hours.

[0073] (3) Dilute 5 μg of the immunodeficiency plasmid DNA in 650 μl of serum-free and antibiotic-free DMEM medium, and mix gently.

[0074] (4) Dilute 10 μl of Lipofectamine 2000 reagent (mix gently before use) in 650 μl of serum-free and antibiotic-free DMEM medium, and incubate at room temperature for 5 minutes.

[0075] (5) Mix the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, and particularly discloses a recombinant immunodeficiency plasmid and virus and application thereof. The immunodeficiency plasmid comprises LTR, gag gene, nucleotide sequence disclosed as SEQ ID No.1, vif gene, vpr gene, vpx gene, tat gene, rev gene, env gene and nef gene. The nucleotide sequence disclosed as SEQ ID NO.1 is introduced to the pathogenic SIVmac239 full-length plasmid frame to construct the immunodeficiency plasmid comprising a plurality of drug target spots, and packaging is performed in the 293T cell to generate immunodeficiency virus. The virus has the capacity for infecting target cells and the capacity of efficient replication, and is applicable to researching human immunodeficiency virus (HIV) in-vivo infection process, pathogeny characteristic, pathogenesis and immunoreaction and screening anti-HIV drugs and anti-HIV drug application strategies.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a recombinant immunodeficiency plasmid and virus and their application. Background technique [0002] AIDS, Acquired Immune Deficiency Syndrome (AIDS), is an immunodeficiency disease caused by infection with Human Immunodeficiency Virus (HIV), and can be complicated by a series of opportunistic infections and Tumor, a syndrome that can lead to death in severe cases. It has been more than 30 years since human beings first discovered HIV in 1983, and the virus still seriously threatens human health and life. Vaccines and drugs are the two main ideas and research directions for the prevention and treatment of infectious diseases. So far, the research and development of AIDS vaccine has not been successful, and clinical drug treatment still occupies a dominant position. [0003] The anti-AIDS drugs currently used in clinic generally have strong toxic side effects, seriously damage oth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/66C12N7/01
Inventor王卫鞠斌董志会丛喆鲍琳琳魏强秦川
OwnerINST OF LAB ANIMAL SCI CHINESE ACAD OF MEDICAL SCI