Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting TERT (telomerase reverse transcriptase) gene promoter mutation, and detection method of kit

A technology of promoters and kits, which is applied in biochemical equipment and methods, and the determination/inspection of microorganisms to achieve the effects of good safety, simple and fast operation, and high sensitivity

Active Publication Date: 2015-07-29
JIANGSU MICRODIAG BIOMEDICINE TECH CO LTD
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is similar to SSCP, the difference is that SSCP separates single-stranded DNA, and HA method separates double-stranded DNA, which is only suitable for the analysis of small fragments

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting TERT (telomerase reverse transcriptase) gene promoter mutation, and detection method of kit
  • Kit for detecting TERT (telomerase reverse transcriptase) gene promoter mutation, and detection method of kit
  • Kit for detecting TERT (telomerase reverse transcriptase) gene promoter mutation, and detection method of kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] The quality control product involved in the present invention is made up of positive plasmid and negative genome DNA corresponding to TERT gene promoter C228T, C228A, CC242-243TT, C250T, and negative genome DNA is unmutated human blood genome DNA, and its concentration is 10 3 Copy number; the positive plasmid is a mutant sequence containing a mutation site, which was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and connected to the pUC57-Amp vector. After DNA extraction and purification, it was diluted to a concentration of 10 3 Copy number, get positive plasmid. The above mutation site information comes from the NCBI-OMIM database, and the specific mutation sequence is as follows:

[0036] C228T:

[0037] gcgggcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggacccccgccccgtcccgaccccctcccgggtccccggcccagcccc tccgggccctccccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagc...

Embodiment 2

[0066] The minimum detection limit of the four mutation sites of TERT gene promoter was analyzed by using the optimized detection system and reaction program.

[0067] The research on the minimum detection limit mainly includes the following two aspects: 1) The research on the minimum detection limit of the mutation ratio: the ratio of the lowest mutation DNA that can be detected under a certain DNA concentration. 2) Research on the minimum detection limit of DNA concentration: the minimum DNA concentration that can be detected under a certain mutation ratio.

[0068] 1) Research on the minimum detection limit of mutation ratio

[0069] Firstly, accurately dilute the TERT promoter mutation positive quality control product and the Control quality control product, and uniformly dilute to 10 3 For copy number, the dilution is 10 ng / μl of wild-type DNA. After mixing the positive quality control with 10ng / ul negative genome according to the volume ratio of 0:100, 0.01:99.99, 0.5:...

Embodiment 3

[0088] Collect 10 tissue samples and matching urine samples from patients with bladder cancer. After the samples are collected, they are immediately stored in a -80 degree refrigerator. DNA in tissue samples and free DNA (cf-DNA) in urine were extracted using Qiagen kits, and subjected to agarose gel electrophoresis and concentration determination.

[0089] Then, the method of Example 1 was used to detect the mutation sites in the tissue samples and urine samples of 10 cases, and the tissue samples were sequenced at the same time, and the results are shown in Table 7.

[0090] Table 7. Results of colorectal cancer patients detected by the method of the present invention

[0091]

[0092] Note: "-" means that the sample has no amplification curve at this site or the sequencing result is negative

[0093] The results show that the coincidence rate of mutations in urine samples detected by the method of the present invention and the urine samples detected by the sequencing me...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting TERT (telomerase reverse transcriptase) gene mutation, and a detection method of the kit. The kit comprises an LNA (locked nucleic acid) modified specific probe for a TERT gene mutation site, wherein the specific probe can be combined with wild DNA (deoxyribonucleic acid), and can detect a sample containing 0.01% TERT gene mutation DNA; and a minimum detection limit is 2-5cp. The detection method for detecting the TERT gene mutation has the advantages of high specificity, high sensitivity, low pollution, simplicity and rapidness in operation, safety and the like, is especially suitable for detecting the gene mutation from body fluids containing low mutation content such as plasma, urine and saliva, is suitable for performing early screening and diagnosis on a bladder cancer, and provides guidance for personalized medicine.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a kit for detecting the mutation of the TERT gene promoter, and also relates to a method for detecting the mutation of the TERT gene promoter in non-disease diagnosis by using the kit. Background technique [0002] Telomerase is a ribonucleoproteinase that plays a crucial role in the replication of chromosome ends in most eukaryotes. Telomerase is composed of catalytic protein and RNA template, which can synthesize DNA at the end of chromosomes, so that telomeres will not be lost due to cell division, and the number of cell division clones will increase. Telomerase is inactive or inactive in normal somatic cells, but active in germ cells, stem cells and cancer cells. Telomerase reverse transcription (TERT), the catalytic part of telomerase, is located on the short arm of chromosome 5 and regulates telomerase activity. TERT has been found to be active in human tumor stud...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 王弢李宗飞孙爱娟李杰张丽
Owner JIANGSU MICRODIAG BIOMEDICINE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com