Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Dna sequence and expression vector for circular rna expression and application thereof

A technology of DNA sequence and expression vector, which is applied in the direction of recombinant DNA technology, DNA/RNA fragments, and the use of vectors to introduce foreign genetic material. The result is a stable effect

Active Publication Date: 2017-03-15
GUANGZHOU FOREVERGEN HEALTH TECH CO LTD
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2014, Liang studied the intron sequences on both sides of a highly expressed circRNA (hsa_circ_0001727), and constructed a circRNA expression vector, but the vector has limitations, and only a few circRNAs can be successfully expressed with this vector. Low success rate[20]
[0010] The circRNA overexpression method reported in the literature needs to amplify the sequence of the circRNA itself and its upstream and downstream sequences, and insert the reverse complement of the upstream sequence into the downstream. The construction method is cumbersome, the experiment is difficult, and the experiment period is long. great change
[0011] In 2014, Liang studied the intron sequence on both sides of a highly expressed circRNA (hsa_circ_0001727), and found that the upstream and downstream sequences of about 50 bp are critical to the production of circRNA, thus constructing a circRNA Expression vector, but the vector has limitations, some circRNAs can be expressed successfully with this vector, some cannot, and the success rate is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dna sequence and expression vector for circular rna expression and application thereof
  • Dna sequence and expression vector for circular rna expression and application thereof
  • Dna sequence and expression vector for circular rna expression and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: Construction of pcDNA-circRNA1730 overexpression plasmid

[0052] 1. Primer design:

[0053] Download the linear sequence of the hsa_circ_0001730 circular RNA from the CircBase database:

[0054] >hsa_circ_0001730|NM_004444|EPHB4

[0055] GTACTAAGGTCTACATCGACCCCTTCACTTATGAAGACCCTAATGAGGCTGTGAGGGAATTTGCAAAAGAGATCGATGTCTCCTACGTCAAGATTGAAGAGGTGATTGGTGCAGGTGAGTTTGGCGAGGTGTGCCGGGGGCGGCTCAAGGCCCCAGGGAAGAAGGAGAGCTGTGTGGCAATCAAGACCCTGAAGGGTGGCTACACGGAGCGGCAGCGGCGTGAGTTTCTGAGCGAGGCCTCCATCATGGGCCAGTTCGAGCACCCCAATATCATCCGCCTGGAGGGCGTGGTCACCAACAGCATGCCCGTCATGATTCTCACAGAGTTCATGGAGAACGGCGCCCTGGACTCCTTCCTGCGG

[0056] Primer design with Primer5 software:

[0057] circRNA1730-F: 5' GGGGTACCGTACTAAGGTCTACATCGACCCCTT 3'

[0058] circRNA1730-R: 5' GCTCTAGACCGCAGGAAGGAGTCCAG 3'

[0059] The primer sequences were synthesized by Shanghai Jierui Company.

[0060] 2. PCR catch gene:

[0061] PCR reaction system, 50 ul in total:

[0062] 2mM dNTP 5ul

[0063] 10×KOD buffer 5u...

Embodiment 2

[0157] Example 2: Construction of pLL-circRNA1730 lentivirus and its stable cell line

[0158] 1. Lentiviral packaging

[0159] 1) 24 hours before transfection, 293T cells in the logarithmic growth phase were digested with trypsin, passaged to a 10 cm cell culture dish, and cultured in a 37°C, 5% CO2 incubator. After 24 h, the cells were ready for transfection when the cell density reached 70%-80%. Cell state is critical for virus packaging, so good cell state and low passage times need to be guaranteed.

[0160] 2) Replace the cell culture medium with serum-free medium before transfection.

[0161] 3) Add the prepared DNA solutions (10 μg of pLL-circRNA1730 vector, 5 μg of pGag / Pol vector, 5 μg of pRev vector, and 5 μg of pVSV-G vector) into a sterilized centrifuge tube, and mix well with the corresponding volume of Opti-MEM , to adjust the total volume to 1.5 ml.

[0162] 4) Shake Lipofectamine 2000 reagent gently, take 60μl Lipofectamine 2000 reagent and mix with 1.5ml ...

Embodiment 3

[0183] Embodiment three: QPCR detection

[0184] 1. RNA extraction

[0185] 1) Cell treatment: Add 1ml Trizol to each well of a 6-well plate, pipette repeatedly 10 times with a 1ml pipette tip, collect into an EP tube; centrifuge for 15 minutes at 12000g, and take the supernatant.

[0186] 2) Add 200ul chloroform to the supernatant, mix vigorously up and down for half a minute, and let stand for 3 minutes.

[0187] 3) Centrifuge at 12000g for 15 minutes at 4°C. At this time, it can be seen that the lysate is divided into three layers: the upper layer is RNA in the aqueous phase; the middle layer is DNA, lipids, etc.; the lower layer is cell residues, proteins, polysaccharides, etc.

[0188] 4) Take 500ul of the supernatant into a new EP tube, pipette 167ul three times; add an equal volume of isopropanol, mix well, let stand for 10 minutes, then centrifuge at 12000g for 10 minutes at 4°C.

[0189] 5) Carefully remove the supernatant and be careful not to lose the RNA pellet. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a DNA (deoxyribonucleic acid) sequence used for circular RNA (ribonucleic acid) expression and a vector containing the DNA sequence used for circular RNA expression. The vector is inserted in a eukaryotic expression vector, a lentiviral vector, an adenovirus vector or a retroviral vector to form a series of special expression vectors for circRNA. The DNA sequence and the corresponding expression vector have the best effects, are simple and convenient to operate and are stable in results and efficient in expression (the circRNA expression level is increased by more than a hundredfold). The sequence and the corresponding vector can be widely applied to expression of various circRNA, provide a powerful research tool for the functions and mechanisms of circRNA and provide theoretical support for research and development of further determination of circRNA molecules as novel markers and disease treatment targets.

Description

technical field [0001] The present invention relates to the field of biotechnology, in particular to a DNA sequence for circular RNA expression, a corresponding expression vector and applications thereof. Background technique [0002] Circular RNA (ciucular RNA, circRNA) is a new member of the RNA family that is different from traditional linear RNA. It is a non-coding RNA molecule that does not have a 5' end cap and a 3' end poly(A) tail, and forms a circular structure with a covalent bond. . [0003] Studies have shown that circular RNAs are mainly produced through atypical variable shear processing, and widely exist in various biological cells. Spatiotemporal specificity and other characteristics. Studies have shown that circular RNA is related to neurodevelopment, atherosclerosis, myotonic dystrophy, cancer and other diseases. In addition, the latest research has detected the presence of circular RNA in human saliva and blood, suggesting that circular RNA can stably e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12N15/63C12N15/79C12N15/861C12N15/867
Inventor 罗景燕李伟琴赖炳权许少飞卢安尚
Owner GUANGZHOU FOREVERGEN HEALTH TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com