Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chitin synthase gene and dsRNA of the brown orange aphid

A chitin synthase, orange aphid technology, applied in DNA/RNA fragments, genetic engineering, DNA preparation and other directions, can solve problems such as unreported, achieve the effect of high silencing efficiency and good application prospects

Inactive Publication Date: 2019-03-15
SOUTHWEST UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The synthesis of chitin in organisms is catalyzed by a series of enzymes, among which chitin synthase (CHS) plays a key role in the last step of synthesis, so the absence of chitin synthase can affect For the normal growth and development of insects, since humans, higher animals, and plants do not contain chitin, the chitin synthesis pathway is relatively safe as a target for pests. The development of new insecticides based on this pathway has great potential in the control of pests. However, there are few related studies on the chitin synthase gene of the brown orange aphid, and there is no report on dsRNA targeting the chitin synthase gene of the brown orange aphid.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chitin synthase gene and dsRNA of the brown orange aphid
  • Chitin synthase gene and dsRNA of the brown orange aphid
  • Chitin synthase gene and dsRNA of the brown orange aphid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. Sequence identification of the chitin synthase gene of the brown orange aphid

[0035] 1) Find a possible chitin synthase Unigene sequence from the transcriptome data of the brown orange aphid (provided by the Key Laboratory of Entomology and Pest Control of Southwest University), and find a unigene sequence in the transcriptome through tBlastn.

[0036] 2) Use the RNA extraction kit RNeasy Plus Micro Kit to extract the total RNA of the brown orange aphid according to the instructions, and then use the reverse transcription kit Perfect real time RT reagent to reverse transcribe 1 μg of the total RNA into cDNA according to the instructions.

[0037] 3) Using the cDNA obtained above as a template, design full-length amplification primers, and use the upstream and downstream primers CHS-A and CHS-S for PCR amplification; the PCR conditions are: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 30 seconds, 60°C Annealing 10s, 72°C extension 5min, a total...

Embodiment 2

[0043] Embodiment 2, the synthesis of the dsRNA of brown orange aphid chitin synthase gene

[0044]1) According to the brown orange aphid transcriptome data (provided by the Key Laboratory of Entomology and Pest Control of Southwest University), design the upstream and downstream primers T7-CHS-S1 (such as SEQ ID NO: 4), T7-CHS-A1 (as shown in SEQ ID NO: 5), synthetic primers, the primer sequences are respectively:

[0045] T7-CHS-S1:

[0046] TAATACGACTCACTATAGGGAGACGTAAAAACTGAAGAC;

[0047] T7-CHS-A1:

[0048] TAATACGACTCACTATAGGGCGTCCATGAAAATGTGAGT.

[0049] 2) Use the RNA extraction kit RNeasy Plus Micro Kit to extract the total RNA of the brown orange aphid according to the instructions, and then use the reverse transcription kit Perfect real time RT reagent to reverse transcribe 1 μg of the total RNA into cDNA according to the instructions. The system is 20 μl, including: total RNA 1 μl (about 1 μg), 5×PrimeScriptBuffer 4 μl, PrimeScriptRT Enzyme Mix I 1 μl, Oligo dT...

Embodiment 3

[0057] Embodiment three, the dsRNA of the chitin synthase gene of the brown orange aphid is introduced into the brown orange aphid:

[0058] use as image 3 The device shown is fed dsRNA to the brown orange aphid, and the operation is as follows:

[0059] 1) Take a clean 50mL centrifuge tube, cut off the conical bottom of centrifuge tube 1 with scissors, take 250μl PCR tube 2 and cut off the bottom of the tube, use double-sided tape to connect the bottom of PCR tube 2 and the cap of centrifuge tube 1 The inner walls are glued together so that the PCR tube 2 is set in the centrifuge tube 1;

[0060] 2) Extend the pipette gun from the bottom of the PCR tube 2 to inject the dsRNA solution prepared above, and place the centrifuge tube 1 upright with the bottom up;

[0061] 3) Take fresh citrus shoots 3, wash them with nuclease-free water and absorb excess water, then insert them into PCR tube 2, then wrap the PCR tube 2 with sealing glue and cut off the gap left by the bottom of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a toxoptera citricida chitin synthase gene. The sequence of the toxoptera citricida chitin synthase gene is shown as SEQ ID NO:3. The invention further discloses dsRNA of the toxoptera citricida chitin synthase gene, and the sequence of the dsRNA is shown as SEQ ID NO:6. The invention further discloses a synthesis method of the dsRNA of the toxoptera citricida chitin synthase gene. The synthesis method includes the following steps that total RNA of toxoptera citricida is extracted and subjected into reverse transcription to form cDNA serving as an amplification template; PCR amplification is carried out through primers with the sequences of SEQ ID NO:4 and SEQ ID NO:5, a product is recycled after electrophoresis, and the dsRNA of the toxoptera citricida chitin synthase gene is synthesized with a gel recycling product as a template. According to the dsRNA of the chitin synthase gene, gene silencing efficiency is high, toxoptera citricida has obvious phenotypic changes after gene interference, and the good application prospects are achieved in the aspect of researching and developing novel pesticide.

Description

technical field [0001] The invention relates to the fields of growth and development regulation and genetic engineering of insects, in particular to a chitin synthase gene of the brown orange aphid and dsRNA thereof. Background technique [0002] Brown orange aphid (Toxoptera citricida) is a worldwide pest of citrus and is the main vector of citrus decay disease virus, which has a great impact on citrus yield and quality. At present, chemical control is still an important measure to control brown orange aphid. Improper application of chemical pesticides not only affects fruit safety, but also leads to serious pesticide resistance. [0003] RNA interference (RNA interference, RNAi) is an important means of gene silencing discovered in recent years. The phenomenon of high-efficiency and specific degradation of homologous RNA is through the mediation of dsRNA to specifically degrade the mRNA of the corresponding sequence. Since the expression of a specific gene can be specifi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N15/113C12N15/10
CPCC12N9/1051C12N15/1137C12N2310/14C12Y204/01016
Inventor 王进军尚峰丁碧月熊英魏冬
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products