Unlock instant, AI-driven research and patent intelligence for your innovation.

Toxoptera citricidus kirkaldy Hunchback gene, dsRNA and synthesis method and novel aphid RNAi method

A synthetic method, the technology of orange aphid, applied in the field of dsRNA and synthesis, brown orange aphid Hunchback gene, new aphid RNA, can solve problems such as improper application of chemical pesticides, impact on fruit safety, drug resistance, etc., and achieve simple and feasible delivery. The effect of high gene silencing efficiency and great application potential

Active Publication Date: 2019-05-14
SOUTHWEST UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Improper application of chemical pesticides not only affects fruit safety, but also leads to serious pesticide resistance
However, there are no related reports on the brown orange aphid Hunchback gene and its dsRNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Toxoptera citricidus kirkaldy Hunchback gene, dsRNA and synthesis method and novel aphid RNAi method
  • Toxoptera citricidus kirkaldy Hunchback gene, dsRNA and synthesis method and novel aphid RNAi method
  • Toxoptera citricidus kirkaldy Hunchback gene, dsRNA and synthesis method and novel aphid RNAi method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1, brown orange aphid ABCG4 gene sequence identification

[0033] 1) Find a possible Hunchback Unigene sequence from the transcriptome data of the brown orange aphid (provided by the Key Laboratory of Entomology and Pest Control of Southwest University), and find a unigene sequence in the transcriptome through tBlastn.

[0034] 2) Use the RNA extraction kit RNeasyPlus Micro Kit to extract the total RNA of the brown orange aphid according to the instructions, and then use the reverse transcription kit Perfect real time RT reagent to reverse transcribe 1 μg of the total RNA into cDNA according to the instructions.

[0035] 3) Using the cDNA obtained above as a template, design amplification primers, and use the upstream and downstream primers Hunchback-A and Hunchback-S for PCR amplification; PCR conditions are: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 30 seconds, 60°C annealing for 10 seconds , Extend at 72°C for 2min, a total of 35 cycles; e...

Embodiment 2

[0041] Embodiment two, the synthesis of the dsRNA of brown orange aphid Hunchback gene

[0042] 1) According to the transcriptome data of the brown orange aphid (provided by the Key Laboratory of Entomology and Pest Control of Southwest University), design the upstream and downstream primers T7-Hunchback-S (as shown in SEQ ID NO:4), T7- Hunchback-A (as shown in SEQ ID NO:5), synthetic primers, primer sequences are respectively:

[0043] T7-Hunchback-S:

[0044] TAATACGACTCACTATAGGGTGCGACTACAAGTGCGTGA;

[0045] T7-Hunchback-A:

[0046] TAATACGACTCACTATAGGGATAGAGTACGGCGACGGATG.

[0047] 2) Use the Trizol reagent to extract the total RNA of the brown orange aphid according to the instructions, and then use the reverse transcription kit Perfect real time RT reagent to reverse transcribe 1 μg of total RNA into cDNA according to the instructions. The reverse transcription system is 20 μl, including : Total RNA 1 μl (about 1 μg), 5×PrimeScript Buffer 4 μl, PrimeScriptRT EnzymeMix...

Embodiment 3

[0055] Embodiment three, the dsRNA of brown orange aphid Hunchback gene is introduced into brown orange aphid

[0056] To deliver dsRNA to the brown orange aphid using a micropipette, follow these steps:

[0057] 1) Cut off the bottom of the 1.5mL centrifuge tube, pour about 1mL of tap water, insert the citrus shoots from the bottom of the centrifuge tube, and then seal the gap between the orifice at the bottom of the centrifuge tube and the stems of the shoots with a paraffin mold. Put it into a petri dish, cover it with gauze, and then fix it around the mouth of the dish with a rubber band to ensure the normal breathing of the brown orange aphid while preventing it from escaping. This device will be used as the brown orange aphid that will be used later. Aphid feeding devices (such as image 3 shown).

[0058] 2) Fix the brown orange aphid with its back facing upwards on the sticky paper.

[0059] 3) Rinse the Hamilton micropipette successively with absolute ethanol and u...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a toxoptera citricidus kirkaldy Hunchback gene, the sequence of which is shown in SEQ ID NO: 3; the invention also discloses dsRNA of the Hunchback gene, the sequence of whichis shown in SEQ ID NO: 6; the invention also discloses a synthesis method of dsRNA of the toxoptera citricidus kirkaldy Hunchback gene, which comprises the following steps of: extracting total RNA, performing reverse transcription to obtain cDNA, performing PCR amplification by using the primer of SEQ ID NO: 4 and the primer of SEQ ID NO: 5, performing electrophoresis on PCR amplification products, recovering products, and performing template synthesis by using gel recovery products to obtain dsRNA. The invention also discloses a novel aphid RNAi method, which comprises the following steps of:fixing backs of toxoptera citricidus kirkaldy upwards, dripping dsRNA of the Hunchback gene on backs of abdomen of toxoptera citricidus kirkaldy, and putting toxoptera citricidus kirkaldy into a culture box for feeding after dsRNA liquid is fully absorbed to surfaces of toxoptera citricidus kirkaldy bodies and become dry.

Description

technical field [0001] The invention relates to the field of growth and development regulation and genetic engineering of insects, in particular to a brown orange aphid Hunchback gene, dsRNA and its synthesis method and a novel aphid RNAi method. Background technique [0002] Brown orange aphid (Toxoptera citricida) is a worldwide pest of citrus and is the main vector of citrus decay disease virus, which has a great impact on citrus yield and quality. At present, chemical control is still an important measure to control brown orange aphid. Improper application of chemical pesticides not only affects fruit safety, but also leads to serious pesticide resistance. [0003] RNA interference (RNA interference, RNAi) is an important gene silencing method discovered in recent years. The phenomenon of high-efficiency and specific degradation of source RNA is the specific degradation of mRNA corresponding to the sequence mediated by dsRNA. Since the expression of a specific gene can...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/113A01N37/46A01P7/04
CPCY02A40/146
Inventor 王进军杨婉君牛金志尚峰
Owner SOUTHWEST UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More