Method for functional verification of brown orange aphid gene

A gene function, brown technology, applied in the field of insect growth and development regulation and genetic engineering, can solve the problems of difficult dsRNA, brown orange aphid introduction of dsRNA, etc., and achieves the effects of high gene silencing efficiency, wide application range and novel design.

Inactive Publication Date: 2020-02-18
SOUTHWEST UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, compared with the brown orange aphid, which is smaller than ordinary insects, it is more difficult to introduce dsRNA by microinjection, and there is no report on the introduction of dsRNA to the brown orange aphid.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for functional verification of brown orange aphid gene
  • Method for functional verification of brown orange aphid gene
  • Method for functional verification of brown orange aphid gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1. Functional verification of the ABCG4 gene of the brown orange aphid

[0053] For the method of functional verification of the brown orange aphid ABCG4 gene, follow the steps below:

[0054] 1. Synthesis of dsRNA:

[0055] 1) According to the cDNA sequence of the brown orange aphid ABCG4 (ABC transporter) gene in the transcriptome data (provided by the Key Laboratory of Entomology and Pest Control of Southwest University), design specific primers for the ABCG4 gene containing the T7 promoter, and synthesize the primers, The sequences of the upstream and downstream primers are:

[0056] T7-ABCG4-S1:

[0057] TAATACGACTCACTATAGGGATGGGAAGTGTTTAACATG;

[0058] T7-ABCG4-A1:

[0059] TAATACGACTCACTATAGGGACATGCCAAATCTATTCCA.

[0060] 2) Use the RNA extraction kit RNeasy Plus Micro Kit to extract the total RNA of the brown orange aphid according to the instructions, and then use the reverse transcription kit Perfect real time RT reagent to reverse transcribe 1 μg o...

Embodiment 2

[0085] Example 2. Verification of the function of the chitin synthase gene of the brown orange aphid

[0086] Carry out functional verification for the brown orange aphid chitin synthase gene (CHS), the operation method is the same as in Example 1, in the "one, dsRNA synthesis" step, according to the chitin synthase gene nucleic acid sequence (Southwest University Entomology The upstream and downstream primers designed to amplify the CHS gene provided by the Key Laboratory of Pest Control are:

[0087] T7-CHS-S1:

[0088] TAATACGACTCACTATAGGGAGACGTAAAAACTGAAGAC;

[0089] T7-CHS-A1:

[0090] TAATACGACTCACTATAGGGCGTCCATGAAAATGTGAGT.

[0091] The PCR reaction conditions were: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 60°C for 10 s, and extension at 72°C for 5 min, a total of 35 cycles; extension at 72°C for 10 min.

[0092] In the "3. Detection of silencing efficiency and phenotype" step, the upstream and downstream primers of the experim...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene function identification method for a toxoptera citricida, comprising the following steps of 1) synthesizing a corresponding ds RNA solution according to a target gene to be inhibited; 2) introducing the ds RNA solution into the toxoptera citricida by using the method disclosed by the invention; 3) collecting toxoptera citricida bodies to extract RNA after culture, and detecting the condition of expression of the target gene in step 1. The method disclosed by the invention is novel in design, simple in operation, and high in efficiency of gene silencing, the obvious phenotypic change is shown after gene interference, research and application costs are low, the problem that an effective introduction method for the ds RNA does not exist at present is solved, RNA interference on the toxoptera citricida can be steadily and effectively performed, the phenotype is observed through the RNA interference, then the prediction function of the target gene of the toxoptera citricida can be indentified, a new pest control method is explored and studied, and the range of application of the method is wide.

Description

technical field [0001] The invention relates to the fields of insect growth regulation and genetic engineering, in particular to a method for verifying the gene function of the brown orange aphid. Background technique [0002] Brown orange aphid (Toxoptera citricida) is a worldwide pest of citrus and is the main vector of citrus decay disease virus, which has a great impact on citrus yield and quality. At present, chemical control is still an important measure to control brown orange aphid. Improper application of chemical pesticides not only affects fruit safety, but also leads to serious pesticide resistance. [0003] RNA interference (RNA interference, RNAi) is an important method of gene silencing discovered in recent years, which refers to the phenomenon of efficient and specific degradation of homologous RNA induced by double-stranded RNA (dsRNA), which is highly conserved during evolution. It is the mRNA of the corresponding sequence that is specifically degraded thr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6851
CPCC12Q1/6851C12Q2521/107C12Q2525/207
Inventor王进军尚峰丁碧月熊英魏冬
OwnerSOUTHWEST UNIV