Method for functional verification of brown orange aphid gene
A gene function, brown technology, applied in the field of insect growth and development regulation and genetic engineering, can solve the problems of difficult dsRNA, brown orange aphid introduction of dsRNA, etc., and achieves the effects of high gene silencing efficiency, wide application range and novel design.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1. Functional verification of the ABCG4 gene of the brown orange aphid
[0053] For the method of functional verification of the brown orange aphid ABCG4 gene, follow the steps below:
[0054] 1. Synthesis of dsRNA:
[0055] 1) According to the cDNA sequence of the brown orange aphid ABCG4 (ABC transporter) gene in the transcriptome data (provided by the Key Laboratory of Entomology and Pest Control of Southwest University), design specific primers for the ABCG4 gene containing the T7 promoter, and synthesize the primers, The sequences of the upstream and downstream primers are:
[0056] T7-ABCG4-S1:
[0057] TAATACGACTCACTATAGGGATGGGAAGTGTTTAACATG;
[0058] T7-ABCG4-A1:
[0059] TAATACGACTCACTATAGGGACATGCCAAATCTATTCCA.
[0060] 2) Use the RNA extraction kit RNeasy Plus Micro Kit to extract the total RNA of the brown orange aphid according to the instructions, and then use the reverse transcription kit Perfect real time RT reagent to reverse transcribe 1 μg o...
Embodiment 2
[0085] Example 2. Verification of the function of the chitin synthase gene of the brown orange aphid
[0086] Carry out functional verification for the brown orange aphid chitin synthase gene (CHS), the operation method is the same as in Example 1, in the "one, dsRNA synthesis" step, according to the chitin synthase gene nucleic acid sequence (Southwest University Entomology The upstream and downstream primers designed to amplify the CHS gene provided by the Key Laboratory of Pest Control are:
[0087] T7-CHS-S1:
[0088] TAATACGACTCACTATAGGGAGACGTAAAAACTGAAGAC;
[0089] T7-CHS-A1:
[0090] TAATACGACTCACTATAGGGCGTCCATGAAAATGTGAGT.
[0091] The PCR reaction conditions were: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 60°C for 10 s, and extension at 72°C for 5 min, a total of 35 cycles; extension at 72°C for 10 min.
[0092] In the "3. Detection of silencing efficiency and phenotype" step, the upstream and downstream primers of the experim...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


