Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

40results about How to "Silent efficiency is high" patented technology

Bone-targeted delivery system for osteogenesis treatment based on small nucleic acid medicine, and preparation method thereof

The invention provides a bone-targeted delivery system for osteogenesis treatment based on small nucleic acid medicine, and a preparation method thereof. The bone-targeted delivery system comprises liposome, bone-targeted molecules and small nucleic acid medicine, wherein the bone-targeted molecules are one or more selected from bisphosphonate, eight aspartic acid polypeptide repeat sequences, six aspartic acid-serine-serine polypeptide repetitive sequences and screened out aptamer aiming at osteoblastlike cells; and the small nucleic acid medicine is one or more selected from blocking agents of small interfering ribonucleic acid, micro ribonucleic acid mimics and micro ribonucleic acid which have the function of promoting bone formation. Compared with conventional bone-targeted delivery systems, the bone-targeted delivery system has stronger specificity and high transfection efficiency for the small nucleic acid, and can reach relatively high silencing efficiency.
Owner:THE CHINESE UNIVERSITY OF HONG KONG

Tobacco squalene synthase?protein, tobacco squalene synthase?gene and application

The invention discloses a tobacco squalene synthase?protein, the?amino acid sequence?of which is as shown in SEQIDNO: 1. Tobacco squalene synthase?gene (i) NtSQS ( / i) is a?key regulatory gene?in tobacco sterol synthesis pathway?and has a specific high expression level in?tender?tissue.?Virus mediated?gene silencing?vector TRV-NtSQS which is constructed is?inoculated to?Ben's tobacco?so as to obtain a plant with high efficiency of silence. By detection of?phytosterol?content in?Ben's tobacco, the phytosterol?content in the?gene silencing?plant is found to be?observably?decreased?by 41.26%. The above?phenomenon?indicates that?the sterol content?in a plant can be significantly reduced by silencing?the gene. Tobacco squalene synthase?gene (i) NtSQS ( / i) is the?key regulatory genein tobacco sterol synthesis pathway, can be used to adjust the sterol content?in tobacco and contributes to?genetic engineering breeding?of low sterol?high quality tobacco.
Owner:ZHENGZHOU TOBACCO RES INST OF CNTC

Application of inhibitor of GINS2 genes or protein to preparation of antitumor drugs

The invention relates to application of an inhibitor of GINS2 genes or protein to the preparation of antitumor drugs. A small-molecular interference RNA sequence aiming at the human GINS2 genes, an RNA interference vector and an RNA interference lentivirus are designed, the silencing efficiency of the GINS2 genes and influence of the GINS2-siRNA lentivirus on the proliferation capacity and apoptosis level of tumor cells are further detected, results show that the proliferation and growth of the tumor cells can be inhibited effectively and the apoptosis of the tumor cells can be promoted after an RNAi method is used to lower the expression of the GINS2 genes, the results indicate that the GINS2 genes are proto-oncogenes and can be used as the targets of tumor treatment, and the RNAi method for silencing the expression of the GINS2 can be used as an effective method to inhibit tumor development. The built siRNA, the RNA interference vector and the RNA interference lentivirus can be used for preparing efficient antitumor drugs.
Owner:SHANGHAI SEVENTH PEOPLES HOSPITAL

Gene silencing method Si-VIGS (Seed imbibition-virus-induced gene silencing) in early stage of cotton

The invention belongs to the technical field of cotton breeding, and specifically relates to a gene silencing method in early germination and seedling stage of cotton. The method comprises the steps of preparing agrobacterium liquid for transfection, performing virus amplification by utilizing tobacco, infecting cotton seeds and the like. According to the invention, a cotton gene silencing technology is optimized and improved by taking a tobacco rattle virus (TRV) as a virus vector. It is proved by a result that a gene silencing phenotype can be obtained through inoculating cotton cotyledon orseeds with TRV homogenate or agrobacteria. Through comparing the similarities and differences of TRV homogenate and agrobacteria inoculation, it is discovered that through applying a seed imbibition(Si) method to inoculation of any infection liquid, the virus inoculation time can all be advanced to the inflorescence primordial formation stage of the seeds; functional genes during germination ofthe seeds can be efficiently silenced within 3 days; virus homogenate-mediated gene silencing can last till the seedling stage of the cotton. Si-VIGS (Seed imbibition-virus-induced gene silencing) involved in the invention can efficiently silence the genes from the early germination stage of the cotton; the operation is simple; the phenotypes are unified; a relatively good application prospect isshown.
Owner:ZHENGZHOU UNIV

Composite material of functional mesoporous silica loaded drug and siRNA, preparation and application thereof in preparation of anticancer drugs

Belonging to the fields of functional material loaded drugs and gene technologies, the invention discloses a composite material of a functional mesoporous silica loaded drug and siRNA, a preparation method and application thereof in preparation of anticancer drugs. The composite material is prepared by the method comprising the steps of: adding mesoporous silica into a 3-mercaptopropyl trimethoxysilane solution, conducting heating reaction and separation to obtain thiolated mesoporous silica, dispersing the thiolated mesoporous silica into a 2, 2-dithiodipyridine solution, and carrying out heating reaction to obtain disulfide bond modified mesoporous silica, adding the disulfide bond modified mesoporous silica into a doxorubicin water solution, then adding thiolated siRNA, and conducting separation, thus obtaining the composite material of the functional mesoporous silica loaded drug and siRNA. The composite material provided by the invention can be applied to preparation of anticancer drugs, can load drugs into cells, significantly improves the enrichment amount of drugs in cells, plays a good mesopore blocking role, and reaches the effect of silencing gene when released in cells.
Owner:JINAN UNIVERSITY

Tobacco squalene epoxidase protein, tobacco squalene epoxidase gene and applications of tobacco squalene epoxidase gene

The invention discloses a tobacco squalene epoxidase protein with an amino acid sequence shown in SEQIDNO:1. A tobacco squalene epoxidase gene NtSE is a key control gene in the synthetic route of sterol in tobaccos. The gene is specifically highly expressed in young tissues, a built virus mediated gene silenced carrier TRV-NtSE is inoculated to a Ben's tobacco, and then a plant with a high silencing efficiency is obtained; through detecting the content of phytosterol in the Ben's tobacco, a situation that the sterol content of the gene silenced plant is significantly reduced by 21.37% is found, which shows that the silencing of the gene can significantly reduce the sterol content of the plant. The tobacco squalene epoxidase gene NtSE is a key control gene in the synthetic route of sterol in tobaccos, can be used for regulating the sterol content of tobaccos, and facilitates the genetic engineering breeding of low-sterol high-quality tobaccos.
Owner:ZHENGZHOU TOBACCO RES INST OF CNTC

Toxoptera citricida chitin synthase gene and dsRNA thereof

The invention discloses a toxoptera citricida chitin synthase gene. The sequence of the toxoptera citricida chitin synthase gene is shown as SEQ ID NO:3. The invention further discloses dsRNA of the toxoptera citricida chitin synthase gene, and the sequence of the dsRNA is shown as SEQ ID NO:6. The invention further discloses a synthesis method of the dsRNA of the toxoptera citricida chitin synthase gene. The synthesis method includes the following steps that total RNA of toxoptera citricida is extracted and subjected into reverse transcription to form cDNA serving as an amplification template; PCR amplification is carried out through primers with the sequences of SEQ ID NO:4 and SEQ ID NO:5, a product is recycled after electrophoresis, and the dsRNA of the toxoptera citricida chitin synthase gene is synthesized with a gel recycling product as a template. According to the dsRNA of the chitin synthase gene, gene silencing efficiency is high, toxoptera citricida has obvious phenotypic changes after gene interference, and the good application prospects are achieved in the aspect of researching and developing novel pesticide.
Owner:SOUTHWEST UNIVERSITY

Branched polyetherimide material containing ketone thioacetal bond, as well as preparation method and application thereof

The invention discloses a branched polyetherimide material containing a ketone thioacetal bond, as well as a preparation method and application thereof. The preparation method comprises the followingsteps: (1) stirring acetone and acid containing thiol to react at room temperature; (2) adding polyetherimide and an activator after the reaction is finished, dissolving in an organic reagent, stirring to react, bonding chlorin e6 and carboxyl polyethylene glycol through an amidation reaction to obtain the reactive oxygen sensitive branched polyetherimide material containing the ketone thioacetalbond. The branched polyetherimide material has excellent biocompatibility and degradability, is entrapped with siRNA, and forms nano-particles by self-assembly, can generate a great number of reactiveoxygen under excitation of a light source with specific wavelength to destroy the structure of endosome, the reactive oxygen sensitive ketone thioacetal bond is broken, particles are disintegrated, and endosome escape and release of intracellular siRNA can be accelerated. The branched polyetherimide material containing a ketone thioacetal bond has a huge clinical application potential in the field of tumor treatment.
Owner:SOUTH CHINA UNIV OF TECH

A bactrocera dorsalis Taiman gene, a detecting method of variable spliceosomes thereof and dsRNA of the gene

A bactrocera dorsalis Taiman gene is disclosed. The nucleotide sequence of the gene is shown as SEQ ID NO:11 or 12 or 13 or 14. Segmented amplification primer pairs for amplifying the full-length bactrocera dorsalis Taiman gene are also disclosed. Sequences of the primers are shown as SEQ ID NO:1 to SEQ ID NO:10 in order. The invention also discloses dsRNA of the gene, a synthetic method thereof and applications of the dsRNA. The invention discloses a method of subjecting the gene to qRT-PCR detection. Sequences of primers used in qPCR are shown as SEQ ID NO:27 and SEQ ID NO:28. The invention also discloses methods of performing qRT-PCR detection on the Taiman gene shown as the SEQ ID NO:11, 12, 13 and 14 respectively and primer sequences are shown as SEQ ID NO:29 to SEQ ID NO:36 respectively.
Owner:SOUTHWEST UNIV

Bone-targeted delivery system for osteogenesis treatment based on small nucleic acid medicine, and preparation method thereof

The invention provides a bone-targeted delivery system for osteogenesis treatment based on small nucleic acid medicine, and a preparation method thereof. The bone-targeted delivery system comprises liposome, bone-targeted molecules and small nucleic acid medicine, wherein the bone-targeted molecules are one or more selected from bisphosphonate, eight aspartic acid polypeptide repeat sequences, six aspartic acid-serine-serine polypeptide repetitive sequences and screened out aptamer aiming at osteoblastlike cells; and the small nucleic acid medicine is one or more selected from blocking agents of small interfering ribonucleic acid, micro ribonucleic acid mimics and micro ribonucleic acid which have the function of promoting bone formation. Compared with conventional bone-targeted delivery systems, the bone-targeted delivery system has stronger specificity and high transfection efficiency for the small nucleic acid, and can reach relatively high silencing efficiency.
Owner:THE CHINESE UNIVERSITY OF HONG KONG

Turnip yellow mosaic virus (TYMV)-induced cruciferous endogenous gene silencing method and application thereof

InactiveCN107557383AVector construction is simpleFast vector constructionGenetic engineeringFermentationEscherichia coliComplementary deoxyribonucleic acid
The invention discloses a turnip yellow mosaic virus (TYMV)-induced cruciferous endogenous gene silencing method and application thereof. The method comprises the steps of taking target gene complementary deoxyribonucleic acid (cDNA) as a template for carrying out polymerase chain reaction (PCR) amplification, purifying a connecting vector, converting escherichia coli, and carrying out positive clone sequencing to obtain a target coding region full-length CDS sequence; according to the sequencing result, selecting a (T / A / G / C) TGA, (T / A / C) TAG or (T / A / C) TAA backwards selection 40bp sequence; adding a reverse complementary sequence into the 3' end, adding sequences, which have the homologous sequence length of 15bp and correspond to the two ends of a linearized vector, into the two ends tosynthesize double-stranded DNA fragments, and enabling the synthesized double-stranded DNA fragments to be in fusion connection with a vector pTY-s, converting the escherichia coli by a product of thefusion connection, culturing and extracting plasmids, carrying out gene gun bombardment when first true leaves of seedlings come up, and rapidly transferring the seedlings into cultivation soil for culturing. The TYMV-induced cruciferous endogenous gene silencing method is easy in vector construction, high in transfection efficiency and obvious in gene silencing effect, and maintains characters to be enduring.
Owner:NANJING AGRICULTURAL UNIVERSITY

Method for establishing and identifying core fucosyltransferase gene silencing cell model

The invention discloses a method for establishing a core fucosyltransferase gene silencing cell model, which comprises the following steps of: selecting the most effective RNA (ribonucleic acid) interference target sequence; synthesizing two sections of complementary oligonucleotides in vitro; and recombining the siRNA fragment of Fut8 gene into retrovirus plasmid pSINsi-hU6 by use of the enzyme digestion sites BamH I and Cla I on a carrier. Through 293T cell packing, the titer of the recombinant retrovirus can reach 2.1*10<5>CFU / ml, and the B cell strain is subjected to 400-1,000mu g / ml G418 screening to obtain a stable expression strain before infection of the generated recombinant retrovirus. The detection result of Real time-PCR and high performance liquid chromatography (HPLC) indicates that the activity of Fut8mRNA and enzyme is obviously reduced in the Fut8siRNA replication-defective recombinant retrovirus-infected 70Z / 3 cell. The method disclosed by the invention has the advantages of easiness in operation, high gene silencing efficiency, good repeatability and the like. The establishment of a Fut8 gene silencing cell model lays a foundation for the biological function study of Fut8 gene.
Owner:DALIAN UNIV

Method for gene function identification of orange panonychus citri

InactiveCN104651499ASilent efficiency is highSolve the problem that there is no efficient dsRNA delivery methodMicrobiological testing/measurementDNA preparationMicrobiologyTarget gene
The invention relates to a method for gene function identification of orange panonychus citri. The method comprises the following steps: (1) preparing a target gene dsRNA liquid: synthesizing a corresponding dsRNA liquid according to a target gene to be inhibited; (2) preparing a leaf disc by using an orange leaf and washing; (3) drying the leaf disc until the leaf disc obviously shrinks, containing the dsRNA liquid prepared in the step 1 by using a centrifugal tube cover, and floating the leaf disc on the dsRNA liquid until the leaf disc is recovered to the original shape and does not shrink; (4) putting the orange panonychus citri on the floating leaf disc, putting the leaf disc in an incubator and culturing for 60 to 80 hours at a condition that the temperature is 22 to 28 DEG C, the humidity is 55% to 65% and the illumination to darkness ratio is 14h:10h; (5) after the culture is ended, collecting orange panonychus citri bodies, extracting RNA, and detecting the expression condition of the target gene provided in the step 1. The method disclosed by the invention can be used for solving the problem that no effective dsRNA introduction method is provided for the orange panonychus citri at present.
Owner:SOUTHWEST UNIVERSITY

Application of fermented extract of sea-buckthorn endophyticfungi strain SJ1

The invention discloses application of a fermented extract of a sea-buckthorn endophyticfungi strain SJ1. The application comprises induction of accumulation of plant endogenous salicylic acid (SA), enhancement of efficiency of plant RNA silencing and improvement of resistance of plants to viruses. The fermented extract of the sea-buckthorn endophyticfungi strain SJ1 provided by the invention hasrelatively good preventive effects when the use concentrations are 150 ng / mL and 100 ng / mL, the average preventive effects are 77.45% and 72.88% respectively which are both higher than the preventiveeffect (71.98%) of control 5 ug / mL of 20% moroxydine cupric acetate; according to comprehensive analysis, the use concentration cost of 100-150 ng / mL of the SJ1 fermented extract is lower than that ofthe 20% moroxydine cupric acetate, and the SJ1 fermented extract provided by the invention is more economical in use.
Owner:SHANDONG AGRICULTURAL UNIVERSITY +1

siRNA for inhibiting HMGB1 gene, stable nucleic acid lipid nanoparticle containing siRNA, and application of siRNA and stable nucleic acid lipid nanoparticle

ActiveCN111363746AConvenient treatmentSignificant anti-inflammatory effectOrganic active ingredientsGenetic material ingredientsHepatic macrophageLiver macrophage
The invention provides siRNA for inhibiting an HMGB1 gene, a stable nucleic acid lipid nanoparticle containing the siRNA, and an application of the siRNA and the stable nucleic acid lipid nanoparticle. The positive-sense strand of an siRNA molecule is SEQ ID NO:1, and the antisense chain is SEQ ID NO:2. The technical effects are as follows that the siRNA aiming at the HMGB1 is encapsulated in thestable nucleic acid lipid nanoparticle, so that the siRNA is prevented from being degraded by in-vivo enzymes; the prepared nanoparticle has a significant anti-inflammatory effect; and the siRNA aiming at the HMGB1 can be targeted and delivered to liver macrophages for release to enhance the anti-inflammatory effect, so that non-alcoholic steatohepatitis (NASH) can be better treated.
Owner:EAST CHINA NORMAL UNIV

Tobacco squalene epoxidase protein, tobacco squalene epoxidase gene and its application

The invention discloses a tobacco squalene epoxidase protein with an amino acid sequence shown in SEQIDNO:1. A tobacco squalene epoxidase gene NtSE is a key control gene in the synthetic route of sterol in tobaccos. The gene is specifically highly expressed in young tissues, a built virus mediated gene silenced carrier TRV-NtSE is inoculated to a Ben's tobacco, and then a plant with a high silencing efficiency is obtained; through detecting the content of phytosterol in the Ben's tobacco, a situation that the sterol content of the gene silenced plant is significantly reduced by 21.37% is found, which shows that the silencing of the gene can significantly reduce the sterol content of the plant. The tobacco squalene epoxidase gene NtSE is a key control gene in the synthetic route of sterol in tobaccos, can be used for regulating the sterol content of tobaccos, and facilitates the genetic engineering breeding of low-sterol high-quality tobaccos.
Owner:ZHENGZHOU TOBACCO RES INST OF CNTC

Chitin synthase gene and dsRNA of the brown orange aphid

The invention discloses a toxoptera citricida chitin synthase gene. The sequence of the toxoptera citricida chitin synthase gene is shown as SEQ ID NO:3. The invention further discloses dsRNA of the toxoptera citricida chitin synthase gene, and the sequence of the dsRNA is shown as SEQ ID NO:6. The invention further discloses a synthesis method of the dsRNA of the toxoptera citricida chitin synthase gene. The synthesis method includes the following steps that total RNA of toxoptera citricida is extracted and subjected into reverse transcription to form cDNA serving as an amplification template; PCR amplification is carried out through primers with the sequences of SEQ ID NO:4 and SEQ ID NO:5, a product is recycled after electrophoresis, and the dsRNA of the toxoptera citricida chitin synthase gene is synthesized with a gel recycling product as a template. According to the dsRNA of the chitin synthase gene, gene silencing efficiency is high, toxoptera citricida has obvious phenotypic changes after gene interference, and the good application prospects are achieved in the aspect of researching and developing novel pesticide.
Owner:SOUTHWEST UNIV

Plant DNA virus satellite silent vector and method for constructing and using same

The invention discloses a plant DNA virus satellite silencing vector and a construction and use method for the vector. The plant DNA virus satellite silencing vector comes from a satellite molecule incidental with tobacco curly shoot virus-DNA 1, and introduces a single multi-cloning site at the downstream of a Rep open reading frame of the DNA 1. The invention also provides a method for studyingthe functional gene group of plants by taking use of the plant DNA virus satellite silencing vector. The recombinant virus satellite silencing vector containing the target gene of plant is constructed by cloning a cDNA section containing plant target gene by RT-PCR method and inserting the multi-cloning site of DNA 1 virus satellite silencing vector. The recombinant virus satellite silencing vector and DNA-A of China tomato yellowing leaf curling virus are injected and inoculated into a plant by agrobacterium to induce and silence the target gene of the plant so that the surface of the plant will change, and real-time fluorescent quantitative RT-PCR technology is used to detect the expression volume of the target gene so as to determine the function of the gene.
Owner:ZHEJIANG UNIV

Application of circular RNAhsa_circ_0007015 in preparation of medicine for preventing and treating chronic kidney disease

The invention discloses an application of circular RNAhsa_circ_0007015 in preparation of a medicine for preventing and treating a chronic kidney disease. The target inhibitor of the hsa_circ_0007015 gene can be used for inducing the silencing of the hsa_circ_0007015 gene through RNA (Ribonucleic Acid) interference, so that the occurrence of renal fibrosis is reduced. According to the gene therapy method, expression of fibrosis-related proteins such as [alpha]-SMA, Collagen I and FN in renal tubular epithelial cells can be remarkably reduced, and meanwhile, the renal fibrosis degree after ischemia-reperfusion injury and unilateral ureteral obstruction of adult mice is remarkably improved. Therefore, a targeted inhibitor of the hsa_circ_0007015 gene can play a role in protecting the kidney, and the hsa_circ_0007015 gene serving as a novel gene medicine can be applied to the aspects of treating chronic kidney diseases, relieving the renal fibrosis degree, improving the renal function and the like.
Owner:THE FIRST AFFILIATED HOSPITAL ZHEJIANG UNIV COLLEGE OF MEDICINE

Virus-induced turnip gene silencing system and application thereof

The invention discloses a virus-induced turnip gene silencing system and application thereof. The invention provides a method for silencing a target gene in turnip. The method comprises the following steps of: (1) designing an interference sequence according to the target gene and a specific principle; (2) preparing an interference vector, wherein a starting vector of the interference vector is a pTY-S vector, and the interference vector has the interference sequence obtained in the step (1) and a reverse complementary sequence thereof; and (3) rubbing leaves of a turnip plant to make a wound, and then inoculating the interference vector. The virus-induced turnip gene silencing system has the beneficial effects that agrobacterium transfection is not needed, and complex steps such as gene gun bombardment are omitted; and the turnip virus-induced gene silencing system is established, simple rubbing inoculation is adopted, the duration is short, the operation is simple, the damage to plants is small, the silencing efficiency is greatly improved, and silencing phenotypes of a plurality of organs can be observed at the same time. The virus-induced turnip gene silencing system has important significance for variety improvement of brassica crops.
Owner:BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES

A targeted inhibitor of dbf4p1 gene and its use

The invention belongs to the technical field of biomedicine, and in particular relates to a targeted inhibitor of DBF4P1 gene and its application. A targeted inhibitor of the DBF4P1 gene has the effect of inhibiting the expression of the DBF4P1 gene, and the target sequence of the inhibitor is: 5'‑GATATAACGGTGATAGAGCAG‑3' (SEQ ID No.1). Application of the DBF4P1 gene targeting inhibitor in the preparation of drugs for targeted treatment of human brain glioblastoma. The present invention develops a targeted inhibitor of the DBF4P1 gene through RNA interference technology, and the targeted inhibitor can specifically bind the DBF4P1 gene to play a role in inhibiting the expression of the DBF4P1 gene, thereby inhibiting the proliferation and migration of glioblastoma cells and invasion, thereby playing a targeted therapeutic role in inhibiting the growth of glioblastoma. The application of DBF4P1 gene targeting inhibitor can play an important role in the field of glioblastoma gene therapy, and provide new molecular targeted therapy drugs for clinical glioblastoma gene therapy.
Owner:SHENGJING HOSPITAL OF CHINA MEDICAL UNIV

Targeted inhibitor of SNORD83A gene and application of targeted inhibitor

The invention belongs to the technical field of biological medicines, and particularly relates to a targeted inhibitor of an SNORD83A gene and application of the targeted inhibitor. The invention relates to a targeted inhibitor of an SNORD83A gene. The targeted sequence of the inhibitor is 5 '-GAATCGGACAGTGTAGAACC-3' (SEQ ID No.1). The invention also discloses application of the targeted inhibitorof the SNORD83A gene in preparation of drugs for treating human brain glioblastoma. The RNA interference technology is used for developing the targeted inhibitor of the SNORD83A gene, and the inhibitor can be specifically combined with the SNORD83A gene, so that the SNORD83A gene is silenced, the proliferation, migration and invasion capabilities of glioblastoma cells are inhibited, and the glioblastoma cells are prevented from being infected with the SNORD83A gene, the goal of treating glioblastoma is achieved. The targeted inhibitor of the SNORD83A gene plays an important role in the fieldof glioblastoma gene treatment, and a new targeted treatment drug is provided for clinical treatment of glioblastoma.
Owner:SHENGJING HOSPITAL OF CHINA MEDICAL UNIV

VIGS-based efficient peach leaf gene silencing method

The invention relates to a VIGS-based efficient peach leaf gene silencing method, which comprises the following steps: 1, constructing a pCaRNA3-target gene recombinant plasmid, and transferring into agrobacterium tumefaciens GV3101 to obtain positive agrobacterium tumefaciens transferred into the recombinant plasmid; 2, preparing a VIGS transformed bacterium solution by utilizing the positive agrobacterium with the transferred recombinant plasmid, and injecting the VIGS transformed bacterium solution into all completely expanded leaves of a peach seedling with the seedling age of 5-6 completely expanded leaves; and 3, culturing the injected peach seedlings in weak light for 2 days, continuously culturing the peach seedlings in a plant growth room under the conditions of (22 + / -1) DEG C and 16h illumination / 8h darkness, and irrigating a Hoagland nutrient solution during the peach seedling culture period. The practical application of the VIGS gene silencing technology in peaches is optimized, a set of efficient peach leaf gene silencing system is established, the silencing efficiency is high, and the stability is good.
Owner:HUAZHONG AGRI UNIV

Method for functional verification of brown orange aphid gene

The invention discloses a gene function identification method for a toxoptera citricida, comprising the following steps of 1) synthesizing a corresponding ds RNA solution according to a target gene to be inhibited; 2) introducing the ds RNA solution into the toxoptera citricida by using the method disclosed by the invention; 3) collecting toxoptera citricida bodies to extract RNA after culture, and detecting the condition of expression of the target gene in step 1. The method disclosed by the invention is novel in design, simple in operation, and high in efficiency of gene silencing, the obvious phenotypic change is shown after gene interference, research and application costs are low, the problem that an effective introduction method for the ds RNA does not exist at present is solved, RNA interference on the toxoptera citricida can be steadily and effectively performed, the phenotype is observed through the RNA interference, then the prediction function of the target gene of the toxoptera citricida can be indentified, a new pest control method is explored and studied, and the range of application of the method is wide.
Owner:SOUTHWEST UNIV

A nucleic acid delivery carrier and its preparation method and application

The invention provides a nucleic acid delivery carrier, a preparation method and application of the nucleic acid delivery carrier. The nucleic acid delivery carrier is a nanometer self-assembled bodyof an amphiphilic fluorinated material; and the amphiphilic fluorinated material is perfluorooctane-substituted oligomeric polyethyleneimine. According to the nucleic acid delivery carrier provided bythe invention, oligomeric polyethyleneimine and the perfluorooctane material are bonded together, and due to strong hydrophobicity of the perfluor material, not only can the nucleic acid compressingcapability of oligomeric polyethyleneimine be improved, but also the efficiency of cell endocytosis and endosome escape can be improved; positive charges of oligomeric polyethyleneimine not only can be used for electrostatic composition of siRNA, but also can utilize proton sponge effect to promote the endosome escape in the system, and by the combination of electrostatic composition of siRNA andthe endosome escape, the nucleic acid delivery carrier not only has very-high silence efficiency under the serum-free condition, but also can show very high nucleic acid delivery efficiency in the presence of serum, and is expected to be applied in gene therapy based on siRNA or DNA.
Owner:THE NAT CENT FOR NANOSCI & TECH NCNST OF CHINA

Sucrose fatty acid ester embedded cationic liposome gene carrier system and its preparation method and application

The invention relates to a sucrose fatty acid ester embedded type cationic liposome genetic vector system, a preparing method thereof and applications of the method. The genetic vector system is a composition comprising genetic materials and liposomes formed from cationic lipoids and sucrose esters adopted as auxiliary lipoids. The cationic lipoids comprise peptide type cationic lipoids, gemini cationic lipoids and quaternary ammonium salt type cationic lipoids. The sucrose esters comprise sucrose stearate, sucrose palmitate, sucrose laurate, sucrose oleate and sucrose erucate. The vector can effectively compress plasmid DNA and siRNA and is capable of efficient transfection in vitro and in vivo and nearly free of toxicity for cells and mice. The genetic vector system has a good research and application prospect in gene therapy.
Owner:DALIAN NATIONALITIES UNIVERSITY

Toxoptera citricidus kirkaldy Hunchback gene, dsRNA and synthesis method and novel aphid RNAi method

The invention discloses a toxoptera citricidus kirkaldy Hunchback gene, the sequence of which is shown in SEQ ID NO: 3; the invention also discloses dsRNA of the Hunchback gene, the sequence of whichis shown in SEQ ID NO: 6; the invention also discloses a synthesis method of dsRNA of the toxoptera citricidus kirkaldy Hunchback gene, which comprises the following steps of: extracting total RNA, performing reverse transcription to obtain cDNA, performing PCR amplification by using the primer of SEQ ID NO: 4 and the primer of SEQ ID NO: 5, performing electrophoresis on PCR amplification products, recovering products, and performing template synthesis by using gel recovery products to obtain dsRNA. The invention also discloses a novel aphid RNAi method, which comprises the following steps of:fixing backs of toxoptera citricidus kirkaldy upwards, dripping dsRNA of the Hunchback gene on backs of abdomen of toxoptera citricidus kirkaldy, and putting toxoptera citricidus kirkaldy into a culture box for feeding after dsRNA liquid is fully absorbed to surfaces of toxoptera citricidus kirkaldy bodies and become dry.
Owner:SOUTHWEST UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More