Toxoptera citricida chitin synthase gene and dsRNA thereof
A chitin synthase, orange aphid technology, applied in DNA/RNA fragments, genetic engineering, DNA preparation and other directions, can solve problems such as no reports, and achieve the effect of high silencing efficiency and good application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1. Sequence identification of the chitin synthase gene of the brown orange aphid
[0035] 1) Find a possible chitin synthase Unigene sequence from the transcriptome data of the brown orange aphid (provided by the Key Laboratory of Entomology and Pest Control of Southwest University), and find a unigene sequence in the transcriptome through tBlastn.
[0036] 2) Use the RNA extraction kit RNeasyPlusMicroKit to extract the total RNA of the brown orange aphid according to the instructions, and then use the reverse transcription kit PerfectrealtimeRTreagent to reverse transcribe 1 μg of the total RNA into cDNA according to the instructions.
[0037] 3) Using the cDNA obtained above as a template, design full-length amplification primers, and use the upstream and downstream primers CHS-A and CHS-S for PCR amplification; the PCR conditions are: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 30 seconds, 60°C Annealing 10s, 72°C extension 5min, a total of 35 ...
Embodiment 2
[0043] Embodiment 2, the synthesis of the dsRNA of brown orange aphid chitin synthase gene
[0044]1) According to the transcriptome data of the brown orange aphid (provided by the Key Laboratory of Entomology and Pest Control of Southwest University), design the upstream and downstream primers T7-CHS-S1 (as shown in SEQ ID NO: 4) to amplify the chitin synthase (CHS) gene shown), T7-CHS-A1 (shown as SEQ ID NO: 5), synthetic primers, the primer sequences are respectively:
[0045] T7-CHS-S1:
[0046] TAATACGACTCACTATAGGGAGACGTAAAAACTGAAGAC;
[0047] T7-CHS-A1:
[0048] TAATACGACTCACTATAGGGCGTCCATGAAAATGTGAGT.
[0049] 2) Use the RNA extraction kit RNeasyPlusMicroKit to extract the total RNA of the brown orange aphid according to the instructions, and then use the reverse transcription kit PerfectrealtimeRTreagent to reverse transcribe 1 μg of total RNA into cDNA according to the instructions. The reverse transcription system is 20 μl, including: 1 μl of totalRNA (about 1 μg...
Embodiment 3
[0057] Embodiment three, the dsRNA of the chitin synthase gene of the brown orange aphid is introduced into the brown orange aphid:
[0058] use as image 3 The device shown is fed dsRNA to the brown orange aphid, and the operation is as follows:
[0059] 1) Take a clean 50mL centrifuge tube, cut off the conical bottom of centrifuge tube 1 with scissors, take 250μl PCR tube 2 and cut off the bottom of the tube, use double-sided tape to connect the bottom of PCR tube 2 to the inner wall of the cap of centrifuge tube 1 Stick together so that the PCR tube 2 is set in the centrifuge tube 1;
[0060] 2) Extend the pipette gun from the bottom of the PCR tube 2 to inject the dsRNA solution prepared above, and place the centrifuge tube 1 upright with the bottom up;
[0061] 3) Take fresh citrus shoots 3, wash them with nuclease-free water and absorb excess water, then insert them into PCR tube 2, then wrap the PCR tube 2 with sealing glue and cut off the gap left by the bottom of th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
