The brown orange aphid abcg4 gene and its dsRNA

An orange aphid and brown technology, which is applied to the field of the brown orange aphid ABCG4 gene and its dsRNA, can solve the problems of unseen and little research on the brown orange aphid ABC transporter, and achieves the effects of high silencing efficiency and good application prospects.

Inactive Publication Date: 2018-10-23
SOUTHWEST UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Analysis of ABC transporter transport includes carbohydrates, lipids, peptides and amino acids, heavy metal ions and their conjugates, and toxic metabolites and chemical drugs. The physiological functions of ABC transporters have been extensively studied in bacteria and vertebrates. However, there are few related studies on the ABC transporter of the brown orange aphid, and there is no report on the dsRNA of the ABC transporter gene of the brown orange aphid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • The brown orange aphid abcg4 gene and its dsRNA
  • The brown orange aphid abcg4 gene and its dsRNA
  • The brown orange aphid abcg4 gene and its dsRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1, brown orange aphid ABCG4 gene sequence identification

[0033] 1) Find a possible ABCG4 Unigene sequence from the transcriptome data of the brown orange aphid (provided by the Key Laboratory of Entomology and Pest Control of Southwest University), and find a unigene sequence in the transcriptome through tBlastn.

[0034] 2) Use the RNA extraction kit RNeasy Plus Micro Kit to extract the total RNA of the brown orange aphid according to the instructions, and then use the reverse transcription kit Perfect real time RT reagent to reverse transcribe 1 μg of the total RNA into cDNA according to the instructions.

[0035] 3) Using the cDNA obtained above as a template, design full-length amplification primers, and use the upstream and downstream primers ABCG4-A and ABCG4-S for PCR amplification; the PCR conditions are: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 30 seconds, 60°C Annealing for 10s, extension at 72°C for 2min, 35 cycles in total; ext...

Embodiment 2

[0041] Embodiment two, the synthesis of the dsRNA of ABCG4 gene of brown orange aphid

[0042] 1) According to the brown orange aphid transcriptome data (provided by the Key Laboratory of Entomology and Pest Control of Southwest University), design the upstream and downstream primers T7-ABCG4-S1 (as shown in SEQ ID NO: 4), T7- ABCG4-A1 (as shown in SEQ ID NO:5), synthetic primers, the primer sequences are respectively:

[0043] T7-ABCG4-S1:

[0044]TAATACGACTCACTATAGGGATGGGAAGTGTTTAACATG;

[0045] T7-ABCG4-A1:

[0046] TAATACGACTCACTATAGGGACATGCCAAATCTATTCCA.

[0047] 2) Use the RNA extraction kit RNeasy Plus Micro Kit to extract the total RNA of the brown orange aphid according to the instructions, and then use the reverse transcription kit Perfect real time RT reagent to reverse transcribe 1 μg of the total RNA into cDNA according to the instructions. The system is 20 μl, including: total RNA 1 μl (about 1 μg), 5×PrimeScriptBuffer 4 μl, PrimeScriptRT Enzyme Mix I 1 μl, O...

Embodiment 3

[0055] Embodiment 3, the dsRNA of brown orange aphid ABCG4 gene is introduced into brown orange aphid:

[0056] use as image 3 The device shown is fed dsRNA to the brown orange aphid, and the operation is as follows:

[0057] 1) Take a clean 50mL centrifuge tube, cut off the conical bottom of centrifuge tube 1 with scissors, take 250μl PCR tube 2 and cut off the bottom of the tube, use double-sided tape to connect the bottom of PCR tube 2 and the cap of centrifuge tube 1 The inner walls are glued together so that the PCR tube 2 is set in the centrifuge tube 1;

[0058] 2) Extend the pipette gun from the bottom of the PCR tube 2 to inject the dsRNA solution prepared above, and place the centrifuge tube 1 upright with the bottom up;

[0059] 3) Take fresh citrus shoots 3, wash them with nuclease-free water and absorb excess water, then insert them into PCR tube 2, then wrap the PCR tube 2 with sealing glue and cut off the gap left by the bottom of the tube to prevent subseque...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a toxoptera citricida ABCG4 gene. The sequence of the toxoptera citricida ABCG4 gene is shown as SEQ ID NO:3. The invention further discloses dsRNA of the toxoptera citricida ABCG4 gene, and the sequence of the dsRNA is shown as SEQ ID NO:6. The invention further discloses a synthesis method of the dsRNA of the toxoptera citricida ABCG4 gene. The synthesis method includes the following steps that total RNA of toxoptera citricida is extracted and subjected into reverse transcription to form cDNA serving as an amplification template; PCR amplification is carried out through primers with the sequences of SEQ ID NO:4 and SEQ ID NO:5, a product is recycled after the PCR amplification product is subjected to electrophoresis, and the dsRNA of the toxoptera citricida ABCG4 gene is synthesized with a gel recycling product as a template. According to the dsRNA of the ABCG4 gene, gene silencing efficiency is high, toxoptera citricida has obvious phenotypic changes after gene interference, and the good application prospects are achieved in the aspect of researching and developing novel pesticide.

Description

technical field [0001] The invention relates to the field of growth regulation and genetic engineering of insects, in particular to a brown orange aphid ABCG4 gene and its dsRNA. Background technique [0002] Brown orange aphid (Toxoptera citricida) is a worldwide pest of citrus and is the main vector of citrus decay disease virus, which has a great impact on citrus yield and quality. At present, chemical control is still an important measure to control brown orange aphid. Improper application of chemical pesticides not only affects fruit safety, but also leads to serious pesticide resistance. [0003] RNA interference (RNA interference, RNAi) is an important means of gene silencing discovered in recent years. The phenomenon of high-efficiency and specific degradation of homologous RNA is through the mediation of dsRNA to specifically degrade the mRNA of the corresponding sequence. Since the expression of a specific gene can be specifically inhibited using RNAi technology,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/52C12N15/11C12N15/10
CPCC07K14/43563C12N15/1003C12N15/113C12N2310/10
Inventor王进军尚峰丁碧月熊英魏冬
OwnerSOUTHWEST UNIV