38 results about "Bactrocera" patented technology

The invention relates to the field of plant protection, and specifically relates to a bactrocera dorsalis large-scale feeding method. The method comprises the following steps: adults are fed, wherein a modified artificial feed comprises yeast paste and sucrose with a mass ratio of 1:8; eggs are collected; larva are fed, wherein the larva are fed by using an artificial feed in which a mass ratio of corn flour to yeast powder is 19:7; and pupa are managed. The method has the advantages of high egg production amount, high egg hatching rate, high pupation rate and high eclosion rate.

The invention provides a compound pesticide applied to vegetable cultivation and a preparation method thereof, and belongs to the technical field of pesticides. The compound pesticide is prepared from the following raw materials in parts by weight: peanut shell, waste shii-take sticks, poultry manure, cortex pseudolaricis, artemisia argyi, jasmonic acid, calcium chloride, diatomite and an insecticide, wherein the insecticide is prepared from the following raw materials in parts by weight: 0.5-3 parts of columbianetin, 10-30 parts of torreya grandis fruit, 10-30 parts of amaranthus mangostanus, 5-20 parts of buttercup, 5-20 parts of pomegranate peel, 5-20 parts of ailanthus altissima, 5-15 parts of berchemia, 3-12 parts of wild tobacco, 3-12 parts of hellebore, 3-12 parts of uniflower swisscentaury root and 1-10 parts of verbena. The compound pesticide is applied to the vegetable cultivation, can control a variety of diseases and insect pests, including black spot, anthracnose, leaf spot, plutella xylostella, bactrocera cucurbitae and the like, significantly improves the disease-resistant and insecticidal capabilities of a variety of vegetables, and is stable in pesticidal efficacy.

The invention provides a method for determining the toxicity of Bactrocera cucurbitae feeding pesticide. The method comprises the following steps: introducing 20 to 30 heads of Bactrocera cucurbitae which are hungry for 24 h 3 to 5 days later after emergence into a plastic box through an insect suction pipe and a cloth barrel; diluting Abamectin and a Trichlorfon technical material by acetone into 100 mg / L respectively as mother solutions; preparing a water solution containing 5% honey and 0.5% Twain-80; diluting the medicament mother solutions into five series of working concentrations by using the prepared water solution, taking a culture dish, putting absorbent paper, and using a liquid-moving machine to dropwise add the prepared solutions with five series of working concentrations onto the absorbent paper; using tweezers to put the culture dish to in the plastic box through the cloth barrel; putting the plastic box in an incubator at a specific environment; after 24 hours, taking out the incubator, and feeding with normal feeding food; and counting the death rate. The invention also provides a device for determining the toxicity of the Bactrocera cucurbitae feeding pesticide. Compared with the prior art, the method and the device have the beneficial effects that the operation is simple and the device is easy to manufacture and can be recycled.

The invention provides a method for detecting bactrocera dorsalis based on a visual LAMP (loop-mediated isothermal amplification) technology, which comprises the following steps: 1) designing a specific LAMP primer group by taking a section containing a polymorphic variation site in a bactrocera dorsalis mitochondrial COI gene as a target gene; (2) carrying out LAMP reaction by using the specific LAMP primer group and taking the whole genome DNA of a sample to be detected as a substrate; and 3) after the LAMP reaction is finished, judging whether the sample to be detected is the bactrocera dorsalis or not according to the color development result of the nucleic acid dye for detection. The invention also provides a corresponding primer group and application thereof. The method and the primer group provided by the invention can accurately detect bactrocera dorsalis in 73 species of bactrocera, have high sensitivity, and can be used for visual rapid detection of a detected material in biological quarantine.

The invention relates to an artificial feed for bactrocera cucurbitae larvas and a preparation method thereof. The artificial feed for bactrocera cucurbitae larvas comprises pumpkin, corn powder, beer yeast, sucrose, cassava waste, a preservative, an acidity regulator and water. The invention has at least one of the following advantages and positive effects: by adopting the artificial feed for bactrocera cucurbitae larvas provided by the invention, normal development of bactrocera cucurbitae larvas can be guaranteed while the feed can be kept from mould and peculiar smell at a later stage, and the artificial feed is suitable for indoor mass artificial production of bactrocera cucurbitae larvas. The cassava waste, serving as a novel filling agent, can supplement abundant nitrogen source, vitamins, crude fiber and unsaturated fatty acids for larvas and also realizes moderate viscosity of the artificial feed for bactrocera cucurbitae larvas so as to facilitate the growth and development of larvas.

The invention discloses an HRM primer, a kit and a method for rapidly identifying bactrocera cucurbitae and South Asia fruit flies. The method comprises the steps of firstly, designing and synthesizing a HRM specific primer for distinguishing two kinds of fruit flies based on mitochondrial genomes of bactrocera cucurbitae and South Asia fruit flies; respectively extracting genome DNAs of bactrocera cucurbitae and South Asia fruit flies; carrying out high-resolution real-time fluorescent quantitative PCR analysis by taking the extracted DNAs as templates and EvGreen as a dye; and distinguishingtwo types of bactrocera cucurbitae according to peak difference of melting temperature curves. According to the invention, the problem of rapid identification of two kinds of bactrocera cucurbitae and South Asia fruit flies which are co-hosted and have similar larvae is solved; the HRM method for identifying the two kinds of bactrocera cucurbitae based on mitochondrial genes is established; bactrocera cucurbitae and South Asia fruit flies which are mixed on melon vegetables can be quickly, efficiently and simply distinguished; and the HRM primer, the kit and the method have the advantages ofhigh accuracy, high flux, good repeatability and low cost.

The invention relates to the technical field of insect rearing, and specifically discloses a method for indoor propagation of Bactrocera dorsalis. The method comprises the following steps: Bactroceradorsalis adult rearing; acquisition of Bactrocera dorsalis eggs, namely 8-day-old in summer or 15-day-old in winter Bactrocera dorsalis adults are used, and a culture medium is used as a Bactrocera dorsalis spawning site; Bactrocera dorsalis larva rearing, namely the eggs hatch into larvae in the culture medium, and the larvae feed on the culture medium; and collection of pupa. The method of the invention is used for large-scale propagation of Bactrocera dorsalis, is not restricted by seasons, can rapidly cultivate a large number of Bactrocera dorsalis, and provides experimental materials forthe research on biology, physiology and integrated pest prevention and treatment measures of Bactrocera dorsalis. In the method, the culture medium is used as the spawning site of Bactrocera dorsalisand an egg hatching site, and at the same time, the culture medium is also the feed for larvae, so that an egg collection step is avoided, the mechanical damage to the eggs is reduced, a hatching rateof the eggs is improved, and thereby the purpose of propagation is achieved.

The invention discloses a method for constructing a white-eye strain of bactrocera dorsalis. Cas9 mRNA is mixed with a target gene gRNA, the mixture is injected into an embryo by microinjection, and then the white-eye strain of bactrocera dorsalis is obtained by genetic hybridization. According to the method, the best research steps and technical parameters are considered, a gene editing method for the white-eye strain of bactrocera dorsalis is constructed, the stably genetically pure white-eye strain of bactrocera dorsalis is acquired quickly and accurately, the technical blank is filled, ideal experimental materials and research ideas are provided for biological research of bactrocera dorsalis, and the method has good application prospects.

The invention provides Bactrocera dorsalis neuropeptide gene Corazonin and an acceptor gene thereof Corazonin receptor as well as amplification methods, coded proteins and applications. The Bactrocera dorsalis neuropeptide Corazonin gene is shown in a SEQ ID No.9, and coded protein is shown in SEQ ID No.10; the invention also provides a nucleotide sequence of a Bactrocera dorsalis neuropeptide Corazonin ligand as shown in SEQ ID No.11, and coded protein is shown in SEQ ID No.12; the Bactrocera dorsalis neuropeptide acceptor Corazonin receptor gene is shown in SEQ ID No.13, and coded protein is shown in SEQ ID No.14; the invention also provides applications of nucleotide and amino acid sequences.

The invention relates to the field of fruit fly quarantine technologies, in particular to primers and a method which are used for multi-target fast identification of bactrocera macquart. Nucleotide sequences of the specific primers used for multi-target fast identification of the bactrocera macquart are as shown in SEQ ID NO. 1 and SEQ ID NO. 2; the specific primers can separate the bactrocera macquart from anastrepha schiner, carpomya, ceratitis macleay, dacus, rhagoletis and other diptera species. The specific primers are used for identifying bactrocera macquart species, and have the advantages that the specificity is high, the sensibility is high, and the universality is high.

The invention relates to the technical field of insect raising, and particularly discloses an indoor large-scale breeding method for spalangia endius. The indoor large-scale breeding method comprisesthe following steps: collecting insect sources of bactrocera dorsalis and raising adults; collecting bactrocera dorsalis eggs; raising bactrocera dorsalis larvae; performing management of bactrocera dorsalis pupae; rearing the spalangia endius: putting emerged spalangia endius for raising in a beekeeping cage for 2-3 days for standby use; putting the bactrocera dorsalis pupae into the beekeeping cage for parasitizing; separating parasitized pupae, and emerging to obtain the spalangia endius. The indoor large-scale breeding method for the spalangia endius disclosed by the invention is simple and easy to implement, requires small space and is relatively low in cost, is suitable for indoor large-scale breeding of the spalangia endius, can carry out continuous breeding to obtain a large numberof spalangia endius, and not only can meet the need of experimental study, but also can be used for orchards or vegetable gardens seriously harmed by fly pests to realize biological control on the fly pests.

The invention discloses a preparation method and applications of a cDNA (complementary Deoxyribonucleic Acid) chip for detecting drug resistance level of bactrocera dorsalis resistant to trichlorphon and beta-cypermethrin. Upregulated drug resistance specificity expression gene segments of different resistant strains of bactrocera dorsalis can be obtained respectively by utilizing a forward suppression subtractive hybridization method, the related drug-resistant specificity expression genes are subjected to PCR (Polymerase Chain Reaction) amplification, 118 related resistance specificity gene segments of bactrocera dorsalis resistant to trichlorphon and 103 related resistance specificity gene segments of bactrocera dorsalis resistant to beta-cypermethrin can be obtained through purifying and recovering. The cDNA chip for detecting the resistance of bactrocera dorsalis resistant to trichlorphon and beta-cypermethrin can be constructed by taking the specific resistant target gene segments as DNA probes. The cDNA chip can simply and effectively realize the real-time detection on the drug resistance level of bactrocera dorsalis.

The invention provides a simple bactrocera cucurbitae temperature stress treatment device which comprises a water bath pot, a glass bottle and an LED submersible lamp, wherein the glass bottle and the LED submersible lamp are arranged in the water bath pot; an iron sheet is mounted at the bottom of the glass bottle; a bottle cover is mounted above the glass bottle; a circular hole is formed in the top of the bottle cover; a plastic pipe and a thermometer probe are arranged in the circular hole; the thermometer probe is connected with a thermometer through a connection wire; a submersible lamp suction disk is mounted on the outer surface of the LED submersible lamp; the upper end of the LED submersible lamp is connected with a power line. The invention further provides a simple bactrocera cucurbitae temperature stress treatment method. Compared with the prior art, the simple bactrocera cucurbitae temperature stress treatment device and the simple bactrocera cucurbitae temperature stress treatment method have the following beneficial effects of flexibility and simplicity, and can be used for stress treatment on both bactrocera cucurbitae and other insects.

The invention relates to a fruit fly quarantine technology, in particular to a quarantine fruit fly multi-target rapid identification method. The quarantine fruit fly multi-target rapid identification method comprises the following steps: extracting genome DNA of a to-be-detected sample; performing PCR by taking the genome DNA as a template and by using specific primers as shown in SEQ ID NO.1 and SEQ ID NO.2; and detecting the PCR product by gel electrophoresis, wherein the sample belongs to quarantine fruit flies if a 603bp specific band occurs, and the sample does not belong to the quarantine fruit flies if the 603bp specific band does not occur. The quarantine fruit flies relate to anastrepha schiner, bactrocera macquart, carpomya, ceratitis, dacus fabricius and / or rhagoletis; and the specific primers can distinguish the quarantine fruit flies from other tephritidae and diptera close species, have high universality and provide powerful technological support for effectively preventing and controlling introduction and diffusion of the quarantine fruit flies and protecting the ecological safety in China.

The invention discloses a bactrocera dorsalis attractant. The formula of the attractant is hydrolysate obtained through enzyme hydrolysis of soybean protein and protein of brewer yeast at a certain ratio under a certain condition. The attractant is beneficial to environmental protection and the edible safety of fruits, the ecological environment is not polluted, and the human health and the safety of natural enemies of bactrocera dorsalis are not threatened. The attractant is simple in preparation method and low in production cost, and the condition that relatively high attractive force can be stably kept by the hydrolysate can be ensured. The attractant has relatively good attracting action on male and female worms of the bactrocera dorsalis, so that the targets of controlling the population quantity of the bactrocera dorsalis and reducing the hazard ratio can be achieved, and the bactrocera dorsalis attractant has good popularization significance.

The invention discloses a comprehensive bactrocera cucurbitae prevention and control method. The comprehensive bactrocera cucurbitae prevention and control method comprises the specific steps that 1, a pesticide is sprayed, wherein 320-400 times of efficient cyhalothrin and high lipid membrane powder liquid with the concentration of 26-32 mg / L is sprayed to melon and fruit flowers in a melon and fruit flowering phase; 2, bagging protection is performed, wherein fruits undergo bagging protection within 1-3 days after the melon and fruit flowers fall. According to the method, efficient cyhalothrin and high lipid membrane powder are mixed in use and play a synergistic effect, the usage amount of the efficient cyhalothrin is decreased, the lasting period of the efficient cyhalothrin is prolonged, the bactrocera cucurbitae preventing and control effect is up to 92% or above, and the fruit yield and quality are remarkably improved.

The invention relates to a specific primer and a probe for identifying bactrocera humilis and application thereof. The sequence of the specific primer comprises a sequence shown in SEQ ID NO. 1 and asequence shown in SEQ ID NO. 2. The sequence of the probe comprises a sequence shown in SEQ ID NO. 3. A molecular biology quarantine identification method for quickly detecting the bactrocera humilis,which is established by adopting the primer and / or the probe, has the advantages of high detection rate, short quarantine time, strong specificity, high sensitivity and the like.

The invention relates to a comprehensive preventing and controlling method of bactrocera cucuribitae. The comprehensive preventing and controlling method comprises the following steps of (1) killing juvenile bactrocera cucuribitae; (2) treating a bactrocera cucuribitae source; (3) trapping and killing adult bactrocera cucuribitae; and (4) performing biological preventing and treating, and physical preventing and treating. The comprehensive preventing and controlling method disclosed by the invention is high-efficient, convenient and easy to operate, harm caused by the bactrocera cucuribitae can be effectively controlled, agricultural chemicals are not used, the comprehensive preventing and controlling method is suitable for pollution-free or green-food production of melon type vegetables, the economic value is high, and the environmental protection significance is great.

The invention belongs to the field of quarantine insect detection and relates to species-specific polymerase chain reaction (SS-PCR) specific primers and a kit for fast identification of Bactrocera rubigina. The SS-PCR specific primer pair comprises XF29: 5'GTAGGAACTTCGCTTAGAATTTTAG3' and XR293: 5'GACTTCTTACTAATAGAAGCGTGA3'. The method for fast identification of Bactrocera rubigina by SS-PCR has the advantages of simple processes, high specificity and high sensitivity, can realize identification of Bactrocera rubigina in 8h and can satisfy port fast inspection and quarantine requirements.

The invention relates to a bactrocera cucurbitae solid culture medium. The bactrocera cucurbitae solid culture medium is prepared from the following components in percentage by weight: 5-25% of a pumpkin, 1-15% of a carbon source, 10-46% of a nitrogen source, 0.025-0.1% of a calcium source, 0.25-1% of a curing agent, and the balance of water, wherein the carbon source comprises one or more of monosaccharide, disaccharide or polysaccharide, the nitrogen source comprises yeast powder and / or cereal flour, and the curing agent is agar and / or agarose. The bactrocera cucurbitae larva solid culture medium is simple, efficient, economic, applicable, easy to operate, and capable of saving labor, and meanwhile, can be effectively quantified, the technical problem of indoor manual mass rearing of bactrocera cucurbitae is thoroughly solved, the research and development of the bactrocera cucurbitae solid culture medium in China is promoted extremely significantly, a large number of insect sources are provided for various scientific research of the bactrocera cucurbitae in the future, and the significant economic and social benefits are achieved.

The invention discloses a kit and a method for rapidly identifying three kinds of fruit flies of bactrocera dorsalis, bactrocera cucurbitae and fruit fly of South Asia. The method comprises the following steps: by taking DNA (Deoxyribose Nucleic Acid) of a to-be-detected fruit fly genome as a template, carrying out PCR (Polymerase Chain Reaction) amplification on an mtCOI gene segment: respectively carrying out enzyme digestion on a PCR product by adopting restriction endonuclease SapI, BsmI and / or Sac I; and judging the types of the fruit flies through gel electrophoresis. According to the invention, the COI gene sequence has sequence difference among different fruit flies, then restriction enzyme is utilized to recognize specific enzyme cutting sites, COI gene segments of three fruit flies can be cut into segments with different sizes, and finally, the three fruit flies can be quickly recognized and identified through agarose gel electrophoresis. The method solves the problem of rapid identification and identification of the three kinds of fruit flies which are seriously harmed and difficult to distinguish on fruits and vegetables, ensures the accuracy of identification results, is more efficient and rapid, greatly saves identification time, and has a very good application prospect.

The invention provides a method for detecting bactrocera scutelata hendel based on a visual LAMP (loop-mediated isothermal amplification) technology. The method comprises the steps of: 1, designing a specific LAMP primer group by taking a section containing a specific site in a mitochondrial COI gene of the bactrocera scutelata hendel as a target gene; 2, performing an LAMP reaction by using the specific LAMP primer group and taking the whole genome DNA of a sample to be detected as a substrate; and 3, after the LAMP reaction is finished, judging whether the sample to be detected is the bactrocera scutelata hendel or not according to a color development result of a nucleic acid dye for detection. The invention further provides a corresponding primer combination and application thereof. The method and the primer group provided by the invention can be used for rapidly and accurately detecting the bactrocera scutelata hendel and distinguishing the bactrocera scutelata hendel from other types of tephritidae very close to the bactrocera scutelata hendel, have high sensitivity and can be used for visual and rapid detection on a detected material in biological quarantine.

The invention discloses a cDNA chip for detecting the resistance level of Bactrocera dorsalis against trichlorfon and beta-cypermethrin, a production method and application thereof. The present invention utilizes the forward suppressive subtractive hybridization (suppression subtractive hybridization, SSH) method to respectively obtain different resistant strains of Bacteralis dorsalis drug resistance-specific up-regulated expression gene fragments, and then PCR amplifies each drug resistance-related specific expression gene, purifies and recovers 118 specific gene fragments related to resistance to trichlorfon of Bactrocera dorsalis and 103 specific gene fragments related to resistance to beta-cypermethrin of Bactrocera dorsalis were obtained. Using the above-mentioned specific resistance target gene fragments as DNA probes, a cDNA chip for the detection of Bacteralis dorsalis resistance to trichlorfon and beta-cypermethrin was constructed. The cDNA chip of the invention can simply and effectively realize the real-time monitoring of the drug resistance level of Bactrocera dorsalis.

The invention discloses a long-acting tablet with high attractiveness to citrus fruit flies. The tablet is composed of the following components in percentages by weight: 30-50% of an active ingredient, 30-50% of a carrier, 10-20% of an adsorbent, 1-10% of an excipient, and 0.5-1% of a preservative. The tablet provided by the invention has better attracting effects on different types of male and female fruit flies, the attracting effect on bactrocera dorsalis, bactrocera tau, and bactrocera citri is better than that of a sugar vinegar liquid, and the tablet has the characteristic of a long effect-lasting period, wherein the attracting effect can last for 4 weeks or more, thereby greatly reducing the costs and labor intensity of field attraction prevention and treatment.

The invention discloses an efficient bactrocera vesuviana attractant, and particularly relates to the technical field of bactrocera vesuviana attractants. The efficient bactrocera vesuviana attractant comprises the following raw materials (in parts by weight): 6-12 parts of farnesene, 4-7 parts of nonanal, 4-7 parts of leaf acetate, 5-8 parts of caryophyllene, 5-8 parts of ocimene, 3-12 parts of chamigrene and 4-10 parts of comphene, and comprises auxiliary materials (in parts by weight) comprising 10-16 parts of clean water. According to the method, pheromone, namely farnesene, of the jujube fruit flies is added into volatile substances of the jujube fruit, and farnesene serving as a volatile substance of male flies can effectively absorb sound of the female flies, so that the number of the female flies can be effectively reduced, and the situation that the female flies lay eggs on the fruit and damage the fruit is avoided; and therefore, the attractant has a remarkable female fly attracting effect so as to prevent the female flies from laying eggs on the fruits and affecting the fruits.

The invention discloses an RNA interference carrier of Bactrocera dorsalis sodium ion channel gene, a construction method and application thereof, and belongs to the technical field of genetic engineering. In the present invention, the carrier PFGC5941 is used as the framework, and the forward and reverse specific target fragments of the Bacteralis dorsalis sodium ion channel gene are respectively inserted on both sides of the intron by double enzyme digestion to form a very important region of the RNA interference carrier, and the constructed RNA After the interference expression vector is transformed into the plant, under the drive of its strong promoter CaMV35S, it transcribes to form a "hairpin structure" of double-stranded RNA in the somatic cells, so that the homologous gene fragments in the body after Bactrocera dorsalis eat the plants The normal expression and translation are affected, which interferes with the normal growth and development of insects, achieves the purpose of plant resistance to Bactrocera dorsalis, plays an important role in the control of Bactrocera dorsalis, and reduces the use of chemical pesticides.

The invention relates to the field of plant protection, and specifically relates to a bactrocera dorsalis large-scale feeding method. The method comprises the following steps: adults are fed, wherein a modified artificial feed comprises yeast paste and sucrose with a mass ratio of 1:8; eggs are collected; larva are fed, wherein the larva are fed by using an artificial feed in which a mass ratio of corn flour to yeast powder is 19:7; and pupa are managed. The method has the advantages of high egg production amount, high egg hatching rate, high pupation rate and high eclosion rate.

The invention discloses an LAMP (loop-mediated isothermal amplification) primer group for identifying three common flies of fresh cherries and application of the LAMP primer group. The LAMP primer group comprises a primer group SWD4, a primer group OFF1 and a primer group ECFF4; the nucleotide sequences are shown as sequences 1-12 in a sequence table. The LAMP primer group disclosed by the invention can be used for identifying whether to-be-detected flies belong to three common flies of fresh-eating cherries, i.e., drosophila melanogaster, bactrocera dorsalis and bactrocera tauropean, and can also be used for detecting whether a to-be-detected sample contains three common flies of fresh-eating cherries, i.e., drosophila melanogaster, bactrocera dorsalis and bactrocera tauropean. The method can also be used for distinguishing three common flies of fresh cherries, namely drosophila melanogaster, bactrocera dorsalis and bactrocera cerasus. The LAMP primer group disclosed by the invention has high specificity and high sensitivity, can realize simple, rapid and accurate detection, and is of great significance to the fresh cherry industry and commercial cherry trade.

The invention provides a method for controlling fruit fly pupae through combination of spalangia endius and insecticide. The method finds that when the abamectin is combined with spalangia endius, the abamectin has a good control effect on pupae of tephritidae such as bactrocera dorsalis, bactrocera cucurbitae and bactrocera cucurbitae. The method is simple and convenient to operate and facilitates industrial popularization and application.