Interferon regulatory factor 6(IRF6) and application of inhibitor of factor in treatment of myocardial hypertrophy

A myocardial hypertrophy and inhibitor technology, applied in the field of gene function and application, can solve problems such as little known function, and achieve the effect of promoting myocardial hypertrophy and worsening heart function.

Inactive Publication Date: 2017-03-08
WUHAN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

IRF6 is located at 1q32. Although IRF6 is structurally similar to other members of the IRF family, we know little about its

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Interferon regulatory factor 6(IRF6) and application of inhibitor of factor in treatment of myocardial hypertrophy
  • Interferon regulatory factor 6(IRF6) and application of inhibitor of factor in treatment of myocardial hypertrophy
  • Interferon regulatory factor 6(IRF6) and application of inhibitor of factor in treatment of myocardial hypertrophy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1 Construction of heart-specific IRF6 knockout mice and IRF6 transgenic mice

[0055] 1. Construction of heart-specific IRF6 gene knockout mice (see the construction strategy figure 1 A)

[0056] Use CRISPR-Cas9 technology to construct heart-specific IRF6 knockout mice. First, use the online CRISPR design tool (http: / / crispr.mit.edu) to design a CRISPR target site in introns 2 and 3 of the mouse IRF6 gene. The target sequences are:

[0057] IRF6-sgRNA 1: GGTCTGGGGCGACATTGTACAGC AGG,

[0058] IRF6-sgRNA 2: GGCGTGTTAGTAAGCCGAAGTCAC AGG.

[0059] In addition, a Donor Vector for homology repair was designed, which includes homology arms on both sides, exon 3 in the middle, and two loxp sequences in the same direction.

[0060] (1) Construction of targeting vector: The two primers corresponding to sgRNA1 and sgRNA2 were respectively fused into double-stranded DNA, and then ligated into the pUC57-sgRNA vector treated with restriction enzyme BsaI with T4 DNA ligase. There is a ...

Embodiment 2

[0084] Example 2 Expression of IRF6 in the heart of normal people and patients with cardiomyopathy

[0085] Select normal human hearts (individuals donated by non-cardiac causes) and recipients replaced by patients with dilated cardiomyopathy patients undergoing heart transplantation), and perform SDS-PAGE-Western Blot experiment (Western Blot) on the protein extracted from the heart, combining specificity Antibodies that recognize IRF6 are detected to determine the expression of IRF6, and GAPDH is used as an internal control. Test results such as image 3 As shown, the expression of IRF6 in the heart of patients with dilated cardiomyopathy is significantly up-regulated.

Embodiment 3

[0086] Example 3 Obtaining a model of myocardial hypertrophy

[0087] 1. Grouping of experimental animals: A model of cardiac hypertrophy was established by aortic coarctation (AB) surgery. Randomly divided into 10 groups, grouped as follows: control group sham operation group (α-MHC-MCM Sham, IRF6-flox Sham) and control group AB operation group (α-MHC-MCMAB, IRF6-flox AB), IRF6 gene knockout Mouse sham operation group (IRF6-CKO Sham) and AB operation group (IRF6-CKOAB), non-transgenic mouse sham operation group (NTG Sham) and AB operation group (NTG AB), heart-specific IRF6 transgenic mouse sham operation Group (TG Sham) and AB operation group (TG AB).

[0088] 2. The myocardial hypertrophy model adopts aortic arch constriction (AB) surgery, the model operation process:

[0089] 2.1 Preoperative preparation

[0090] (1) Anesthesia: Weigh the mice first, calculate the required amount of anesthetic (3% sodium pentobarbital) according to 90mg / kg body weight, inject it through the abdo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an interferon regulatory factor 6(IRF6) and application of an inhibitor of the factor in treatment of myocardial hypertrophy and belongs to the fields of gene function and application. The mutual relation between IRF6 gene expression and the myocardial hypertrophy is determined, wherein the myocardial hypertrophy and fibrosis are remarkably inhibited and cardiac functions are improved by inhibiting the IRF6 expression, and the myocardial hypertrophy and fibrosis are remarkably promoted and the cardiac functions deteriorate by promoting the IRF6 expression. Therefore, the IRF6 can serve as a drug target for screening drugs for protecting the cardiac functions, preventing, relieving and/or treating the myocardial hypertrophy or resisting myocardial fibrosis, the inhibitor of the IRF6 can be used for preparing the drugs for protecting the cardiac functions, preventing, relieving and/or treating the myocardial hypertrophy or resisting myocardial fibrosis.

Description

Technical field [0001] The invention belongs to the field of gene function and application, and relates to the application of Interferon Regulatory Factor-6 (Interferon Regulatory Factor-6, IRF6) as a drug target in screening drugs for treating myocardial hypertrophy, and IRF6 inhibitors in preparing drugs for treating myocardial hypertrophy In the application. Background technique [0002] Myocardial hypertrophy refers to the continuous adjustment of normal cardiac myocardium structure and function under the stimulation of biological stretch load or neuroendocrine factors, mainly manifested as changes in ventricular spatial conformation and biological effects, such as local or most or even the entire ventricular wall Or / and thickening of the atrial wall, increased heart mass, accompanied by changes in cardiac ejection function and changes in ventricular wall tension. Pathological myocardial hypertrophy is an important link in the development of cardiac remodeling. Initially, co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K48/00A61K49/00A61K45/00A61K31/713A61P9/00G01N33/50G01N33/53
CPCA61K48/005A61K31/713A61K45/00A61K49/0008G01N33/5061G01N33/53
Inventor 李红良姬燕晓黄赞巩军
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap