Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A gsm2 promoter whose expression is induced by the addition of exogenous sugar

A technology of GSM2 and promoter, applied in the field of genetic engineering, can solve the problem of uncloned ToTAL1 promoter and so on

Active Publication Date: 2020-08-04
SOUTHWEST UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Caillau et al. confirmed that the ToTAL1 gene in tomato is expressed in various tissues of the plant and can be induced by various signals, but the promoter of ToTAL1 was not cloned

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gsm2 promoter whose expression is induced by the addition of exogenous sugar
  • A gsm2 promoter whose expression is induced by the addition of exogenous sugar
  • A gsm2 promoter whose expression is induced by the addition of exogenous sugar

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0018] 1. Promoter cloning

[0019] Download the GSM2 gene DNA sequence from the TAIR (https: / / www.arabidopsis.org / ) database, select the 1.5kb length upstream of ATG as the GSM2 promoter region, and design primers (Table 1). The GSM2 promoter fragment was obtained by PCR, and its nucleotide sequence is shown in figure 2 , (GSM2 promoter fragment electrophoresis as shown in figure 1 As shown, the fragment length is 1500bp), connected into T-vector, and the correct non-mutated GSM2 promoter fragment was obtained by sequencing, and transferred into the binary expression vector containing the reporter gene GUS.

[0020] Table 1 Primer sequences used for amplification of GSM2 promoter.

[0021] Primer name Primer sequences(5`-3`) GSM2pro-F GGTACC TCAGGCGAAGAACAGAAGATG (SEQ ID No. 2)

GSM2pro-R GTC GAC TTTTTTCGTCGAGGGAAATACG (SEQ ID No. 3)

[0022] The underlined sequence is the recognition site of the introduced restriction endonuclease. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a GSM2 promoter induced by exogenous sugar addition to express. A nucleotide sequence of the GSM2 promoter is shown as SEQ ID No. 1. The promoter of a gene GSM2 which is homologous with tomato ToTAL1 in arabidopsis thaliana is cloned; and sequence analysis and functions are verified. The verification proves that the sequence of the GSM2 promoter can be composed of sequencesof ATG upstream 1.5kb; the promoter can be used for starting an exogenous gene GUS to be expressed in the arabidopsis thaliana and tobaccos, and the starting strength can be enhanced by an exogenoussugar signal. According to the GSM2 promoter, an induction type promoter is used for replacing a constitutive promoter and a binary expression vector of the induced type promoter is obtained; the binary expression vector is introduced into a plant genome by utilizing a genetic transformation technology, directional operation of a target gene can be realized and a transgenic plant capable of inducing the expression of the target gene is obtained.

Description

technical field [0001] The invention belongs to the field of genetic engineering, in particular to a promoter whose expression is induced by the addition of exogenous sugar. Background technique [0002] A promoter is an integral part of a gene that is recognized by RNA polymerase and starts transcription. Inducible promoters are different from constitutive promoters. They only start the transcription of foreign genes under the stimulation of certain signals, which can accumulate the expression products of target genes in a certain time and space, increase the expression of regions, and improve the resistance of plants. inverse. To a certain extent, it solves the problem of food safety in transgenic applications, and is an ideal promoter for genetic engineering breeding using plant transgenic technology. [0003] Sugar not only serves as a source of energy and carbon skeleton, but also is an important signaling molecule that regulates plant growth and development. Sugar r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82C12N15/11A01H5/00A01H6/20A01H6/82
CPCC07K14/415C12N15/8237
Inventor 许一丰郑敏朱春艳
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com