Preparation method of ddx19 gene-deleted zebrafish mutant

A gene deletion, t7-ddx19-sfd technology, applied in the field of molecular biology, can solve the problems of different types of mutants, different sizes of encoded proteins, etc.

Inactive Publication Date: 2018-10-30
SHANGHAI OCEAN UNIV
View PDF13 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This may be due to the different sizes of the encoded proteins due to the different deletion positions, resulting in differences in different types of mutants to a certain extent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of ddx19 gene-deleted zebrafish mutant
  • Preparation method of ddx19 gene-deleted zebrafish mutant
  • Preparation method of ddx19 gene-deleted zebrafish mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0058] 1 Materials and equipment

[0059] 1.1 Experimental fish

[0060] The zebrafish used in this experiment were all AB strains, which were purchased from the Zebrafish Platform of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

[0061] 1.2 Plasmid

[0062] The pUC19-gRNA scaffold plasmid is derived from literature: Chang N, Sun C, Gao L, Zhu D, Xu X, ZhuX, Xiong JW, Xi JJ. Genome editing with RNA-guided Cas9nuclease in zebrafishembrvos, Cell Res, 2013, 23(4 ): 465-472.

[0063] The pUC19-gRNA scaffold plasmid template sequence used in gRNA product synthesis is:

[0064] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO. 7).

[0065] 1.3 Main reagents

[0066] DNA Clean&Contentrator-5 (ZYMO RESEARCH, D4004), common DNA purification kit (TIANGEN, DP204-03), T7in vitro Transcription Kit (Ambion, AM1314), ethanol (absolute ethanol) (Sinopharm Chemical...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of a ddx19 gene-deleted zebrafish mutant. The preparation method comprises the following steps: determining a target for ddx19 gene knockout on a first exon of a zebrafish ddx19 gene, and designing a gRNA sequence; with a pUC19--gRNA scaffold plasmid as a template, performing PCR amplification by using primers T7-ddx19-sfd and tracr rev; performing purification and in-vitro transcription on a PCR products to obtain gRNA; introducing gRNA and Cas9 protein into a zebrafish embryo-cell stage, and culturing to obtain a ddx19 gene mutant capable of achieving stable inheritance. By a CRISPR / Cas9 technology, the ddx19 gene-deleted zebrafish mutant capable of achieving stable inheritance is obtained. The invention further discloses a phenotype of the ddx19 gene-deleted zebrafish mutant, and a basic support is provided for biological function research and disease modeling thereof.

Description

technical field [0001] The invention belongs to the field of molecular biology, and specifically relates to a specific method for obtaining ddx19 ​​gene-deficient zebrafish mutants by using CRISPR / Cas9 gene editing technology. Background technique [0002] The CRISPR / Cas system belongs to the adaptive immune defense mechanism of bacteria and archaea. It is produced during the continuous evolution of organisms to protect its own genome from the interference of foreign nucleic acids. In 1987, researchers at Osaka University discovered clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-related genes (CRISPR- associated genes, Cas genes). CRISPR RNA (crRNA) guides the Cas protein in the form of base complementation to recognize the invading foreign genome and cut its DNA. According to the sequence and structure of the Cas protein, the CRISPR / Cas system can be divided into type I, type II and type III. Type I and II CRISPR-Cas systems can degrade ex...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85A01K67/027
CPCA01K67/0276A01K2217/075A01K2227/40A01K2267/03C07K14/461C12N15/8509C12N2800/80C12N2810/10
Inventor张庆华时灿岳倩文李伟明
OwnerSHANGHAI OCEAN UNIV