Preparation method of ddx27 gene deletion zebrafish mutant

A ddx27f1, gene deletion technology, applied in the field of obtaining ddx27 gene deletion zebrafish mutants, can solve the problem of less description of properties and specific functions

Active Publication Date: 2021-11-23
SHANGHAI OCEAN UNIV
View PDF24 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The DExD / H-box family plays an important role in almost all cellular processes involving RNA, such as gene transcription, pre-mRNA splicing, mRNA export, ribosome production, translation initiation, organelle gene expression, RNA degradation, etc., affecting RNA production and RNA polymorphisms, but the properties and specific functions of these enzymes in vivo are still seldom described

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of ddx27 gene deletion zebrafish mutant
  • Preparation method of ddx27 gene deletion zebrafish mutant
  • Preparation method of ddx27 gene deletion zebrafish mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0058] 1 Materials and equipment

[0059] 1.1 Experimental fish

[0060] The zebrafish used in this experiment were all AB strains, which were purchased from the Zebrafish Platform of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

[0061] 1.2 Plasmid

[0062] The pUC19-gRNAscaffold plasmid is derived from the literature: Chang N, Sun C, Gao L, Zhu D, Xu X, ZhuX, Xiong JW, Xi JJ. Genome editing with RNA-guided Cas9nuclease in zebrafishembryos, Cell Res, 2013, 23(4) :465-472.

[0063] The pUC19-gRNAscaffold plasmid template sequence used in gRNA product synthesis is:

[0064] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO. 7).

[0065] 1.3 Main reagents

[0066] DNAClean&Contentrator-5 (ZYMO RESEARCH, D4004), common DNA purification kit (TIANGEN, DP204-03), T7in vitro Transcription Kit (Ambion, AM1314), ethanol (absolute ethanol) (Sinopharm Chemical ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of a zebrafish ddx27 gene deletion mutant, comprising the following steps: confirming that the target of the ddx27 gene knockout is on the sixth exon of the zebrafish ddx27 gene, and designing a gRNA sequence; using pUC19‑‑‑ The gRNA scaffold plasmid was used as the template, and primers T7‑ddx27‑sfd and tracr rev were used for PCR amplification; the PCR product was purified and transcribed in vitro to obtain gRNA; the gRNA and Cas9 protein were introduced into zebrafish and cultured to obtain a stable genetic mutant of the ddx27 gene. In addition, the invention also discloses the phenotype of the ddx27 gene deletion zebrafish mutant, which plays an important role in studying its biological function.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to a specific method for obtaining ddx27 gene-deficient zebrafish mutants by using CRISPR / Cas9 gene editing technology. Background technique [0002] The CRISPR / Cas system belongs to the adaptive immune defense mechanism of bacteria and archaea. It is produced during the continuous evolution of organisms to protect its own genome from the interference of foreign nucleic acids. In 1987, researchers at Osaka University discovered clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-related genes (CRISPR- associated genes, Cas gene). CRISPR RNA (crRNA) guides the Cas protein in the form of base complementation to recognize the invading foreign genome and cut its DNA. According to the sequence and structure of the Cas protein, the CRISPR / Cas system can be divided into type I, type II and type III. Type I and II CRISPR-Cas systems can degrade exog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/90C12N15/113A01K67/027
CPCA01K67/0276C12N15/113C12N15/902C07K14/47C12N2310/20A01K2227/40A01K2217/075A01K2267/0331C07K14/461C12N15/1137C12Y306/04013C12N9/90A01K2207/15A01K2217/056A01K2267/03
Inventor张庆华时灿岳倩文祖尧李伟明
OwnerSHANGHAI OCEAN UNIV