Method and kit for preparing salidroside

A salidroside and kit technology, applied in fermentation and other directions, can solve the problems of complex catalyst preparation process, large amount of organic solvent, low conversion rate, etc., and achieve the effects of saving production steps, reducing production costs and high yield

Active Publication Date: 2021-03-23
BEIJING TECHNOLOGY AND BUSINESS UNIVERSITY +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The main disadvantages of the above-mentioned biocatalytic method are the complex preparation process of the catalyst and the need for a large amount of organic solvent to achieve the condition of micro-aqueous phase.
In addition, most of them use β-glucosidase, which is a hydrolytic enzyme, and their hydrolysis is often greater than their synthesis, so the conversion rate is not high and the yield is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for preparing salidroside
  • Method and kit for preparing salidroside
  • Method and kit for preparing salidroside

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1. Preparation of recombinant thermostable sucrose phosphorylase and recombinant thermostable cellobiose phosphorylase

[0030] Unless otherwise specified, the methods used in the following examples are conventional methods, and the reagents used can be obtained from commercial sources.

[0031] A. Construction of sucrose phosphorylase Escherichia coli recombinant bacteria

[0032] The genome was extracted from Thermoanaerobacterium thermosaccharolyticum as a template, and PCR amplification was performed to obtain a PCR product. PCR conditions were pre-denaturation at 94°C for 2 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1.5 minutes, 30 cycles; incubation at 72°C for 10 minutes.

[0033] Upstream primer: CGC GGATCC ATGGCTCTGAAAAATAAAGTGCAACTG, underlined is the enzyme cleavage site BamHI.

[0034] Downstream primer: CCG CTCGAG CACCAGGTATTTCACTTCTTCGCCGT, the restriction enzyme cleavage site XhoI is...

Embodiment 2

[0045] Embodiment 2. Synthesis of salidroside

[0046] According to the concentration of sucrose 110g / L, tyrosol 42g / L and phosphoric acid 50mmol / L, 1.10g sucrose, 0.42g tyrosol and 57μL phosphoric acid (concentration 85%) were sequentially added to 6ml citric acid buffer (50mmol / L, pH Value 7.0) in the reaction flask (volume specification 25ml), stir to dissolve the reaction raw materials, then add 0.5ml of the recombinant heat-resistant sucrose phosphatase enzyme solution prepared in Example 1 at a concentration of 250U / L, and then press 1200U / L. 1 ml of the recombinant heat-resistant cellobiose phosphatase enzyme solution prepared in Example 1 was added to the concentration of L, and finally the volume of the reaction solution was adjusted to 10 ml with the same citric acid buffer, and the pH of the reaction solution was adjusted to 7.0. Then, it is placed in a constant temperature oscillator to carry out biological reaction to prepare salidroside, and the reaction conditio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a preparation method of rhodioloside and a kit. The preparation method comprises following steps: mixing recombinant heatproof sucrose phosphorylase, recombinant heatproof cellobiose phosphorylase, cane sugar, tyrosol, and phosphoric acid to obtain a reaction mixture; then converting the reaction mixture at a temperature of 40 to 55 DEG C to generate rhodioloside. The preparation method has the advantages of simple technology, low cost, and high yield.

Description

technical field [0001] The present invention relates to a method for catalyzing the preparation of salidroside with enzymes, and more particularly, the present invention relates to a method and a kit for catalyzing the preparation of salidroside using sucrose phosphorylase and cellobiose phosphorylase. Background technique [0002] Salidroside is the main active ingredient of Rhodiola rosea. The content of salidroside in wild Rhodiola plants is about 0.1% to 1.0%. Rhodiola rosea is a precious traditional Chinese medicine and Tibetan medicine. It has various effects such as anti-fatigue, anti-hypoxia, anti-radiation, and improving human function. [0003] Conventionally, salidroside can be obtained by the following three methods: rhodiola extraction, chemical synthesis and biocatalysis. However, in terms of rhodiola extraction, first of all, rhodiola is a plateau plant with limited resources, and the content of salidroside in rhodiola is low, only about 0.1% to 1.0%. Secon...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P19/44C12P19/18
CPCC12P19/18C12P19/44
Inventor王洪钟董银卯黄爱清何聪芬张贵友
OwnerBEIJING TECHNOLOGY AND BUSINESS UNIVERSITY