Method and kit for preparing salidroside
A salidroside and kit technology, applied in fermentation and other directions, can solve the problems of complex catalyst preparation process, large amount of organic solvent, low conversion rate, etc., and achieve the effects of saving production steps, reducing production costs and high yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1. Preparation of recombinant thermostable sucrose phosphorylase and recombinant thermostable cellobiose phosphorylase
[0030] Unless otherwise specified, the methods used in the following examples are conventional methods, and the reagents used can be obtained from commercial sources.
[0031] A. Construction of sucrose phosphorylase Escherichia coli recombinant bacteria
[0032] The genome was extracted from Thermoanaerobacterium thermosaccharolyticum as a template, and PCR amplification was performed to obtain a PCR product. PCR conditions were pre-denaturation at 94°C for 2 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1.5 minutes, 30 cycles; incubation at 72°C for 10 minutes.
[0033] Upstream primer: CGC GGATCC ATGGCTCTGAAAAATAAAGTGCAACTG, underlined is the enzyme cleavage site BamHI.
[0034] Downstream primer: CCG CTCGAG CACCAGGTATTTCACTTCTTCGCCGT, the restriction enzyme cleavage site XhoI is...
Embodiment 2
[0045] Embodiment 2. Synthesis of salidroside
[0046] According to the concentration of sucrose 110g / L, tyrosol 42g / L and phosphoric acid 50mmol / L, 1.10g sucrose, 0.42g tyrosol and 57μL phosphoric acid (concentration 85%) were sequentially added to 6ml citric acid buffer (50mmol / L, pH Value 7.0) in the reaction flask (volume specification 25ml), stir to dissolve the reaction raw materials, then add 0.5ml of the recombinant heat-resistant sucrose phosphatase enzyme solution prepared in Example 1 at a concentration of 250U / L, and then press 1200U / L. 1 ml of the recombinant heat-resistant cellobiose phosphatase enzyme solution prepared in Example 1 was added to the concentration of L, and finally the volume of the reaction solution was adjusted to 10 ml with the same citric acid buffer, and the pH of the reaction solution was adjusted to 7.0. Then, it is placed in a constant temperature oscillator to carry out biological reaction to prepare salidroside, and the reaction conditio...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


