Primer sets and their applications
A primer set and primer combination technology, applied in the biological field, can solve problems such as long detection time and high requirements for experimental operations
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0234] Example 1 Preparation of Primer Group I, Primer Group II, Primer Group III, Primer Group IV and Primer Group V
[0235] The kit consists of four LAMP primer sets, one for each species of Candida.
[0236] The primer set for detecting Rhizopus oryzae is as follows (5'→3'):
[0237] Outer primer F3 (SEQ ID No.1): GGTAGCAAATCCAGTC;
[0238] Outer primer B3 (SEQ ID No.2): CCTCCCAAGCGATC;
[0239] Internal primer FIP (SEQ ID No.3):
[0240] ACGGGTCGTGTCAAGGTTCTGGACTGCCTCCAA;
[0241] Internal primer BIP (SEQ ID No.4):
[0242] CGTCCATCTTGGCGATGTTGGGAATCCCCATGTTCA;
[0243] Loop primer LF (SEQ ID No.5): CCGGAGCCAATGACCT;
[0244] Loop primer LB (SEQ ID No. 6): CTCAATCGGTCCATGC.
[0245] The primer set used to detect Mucorella umbelliferus is as follows (5'→3'):
[0246] Outer primer F3 (SEQ ID No.7): GGGTAAAAAAGGTGGATG;
[0247] Outer primer B3 (SEQ ID No.8): CATTGGATCCCTTTTTC;
[0248] Internal primer FIP (SEQ ID No.9):
[0249] CCAAGAGGTGAGGTTGGGATGTTGCCTCTTCAGCT...
Embodiment 2
[0278] The specificity of embodiment 2 mucormycetes primer combinations
[0279] 1. Preparation of samples to be tested
[0280] Test sample 1: Rhizopus oryzae plasmid
[0281] Test sample 2: Mucorella umbelliferum plasmid
[0282] Test sample 3: Plasmid of Mucor circiniferans
[0283] Sample to be tested 4: Rhizomucor micromus plasmid
[0284] Rhizopus oryzae detection gene plasmid: Insert the DNA molecule with Genebank number AB167714.1 between the MCS of the pEasy-blunt plasmid (Beijing Quanshijin Biotechnology Co., Ltd.) to obtain a recombinant plasmid, which is rice root Mold detection gene plasmid.
[0285] Mucorella umbellatus detection gene plasmid: Insert a DNA molecule with a Genebank number of GQ342716.1 between the MCSs of the pEasy-blunt plasmid (Beijing Quanshijin Biotechnology Co., Ltd.) to obtain a recombinant plasmid, which is the umbrella Mucoral spp. detection gene plasmid.
[0286] Mucor crimperida detection gene plasmid: Insert a DNA molecule with Ge...
Embodiment 3
[0299] Example 3 Mucorales fungi identify the sensitivity of the primer combination
[0300] Sample 1 to be tested: the Rhizopus oryzae gene plasmid DNA to be tested in Example 2.
[0301] Sample 2 to be tested: the gene plasmid DNA of Mucor umbelliferum to be tested in Example 2.
[0302] Test sample 3: the test gene plasmid DNA of Mucor circiniferans of Example 2.
[0303] Sample 4 to be tested: the Rhizomucor pumilii test gene plasmid DNA of Example 2.
[0304] 1. The plasmid DNA of the gene to be tested is serially diluted with sterile water to obtain each dilution.
[0305] 2. Using the dilution obtained in step 1 as a template, respectively use the primer set I, primer set II, primer set III or primer set IV prepared in Example 1 to perform loop-mediated isothermal amplification.
[0306] When the sample to be tested is the sample to be tested 1, the loop-mediated isothermal amplification is performed using primer set I. When the sample to be tested is the sample to be...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap