Supercharge Your Innovation With Domain-Expert AI Agents!

Primer sets and their applications

A primer set and primer combination technology, applied in the biological field, can solve problems such as long detection time and high requirements for experimental operations

Active Publication Date: 2021-02-19
CAPITALBIO CORP
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently established related molecular diagnostic methods include common PCR method, pulsed field gel electrophoresis typing (PFGE), multilocus sequence typing (MLST), restriction fragment length polymorphism analysis (RFLP), real-time fluorescent quantitative PCR technology (RTFQ-PCR), etc., the common problem is that the requirements for experimental operation are high, and the detection time is relatively long (2.5h-3h).

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer sets and their applications
  • Primer sets and their applications
  • Primer sets and their applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0234] Example 1 Preparation of Primer Group I, Primer Group II, Primer Group III, Primer Group IV and Primer Group V

[0235] The kit consists of four LAMP primer sets, one for each species of Candida.

[0236] The primer set for detecting Rhizopus oryzae is as follows (5'→3'):

[0237] Outer primer F3 (SEQ ID No.1): GGTAGCAAATCCAGTC;

[0238] Outer primer B3 (SEQ ID No.2): CCTCCCAAGCGATC;

[0239] Internal primer FIP (SEQ ID No.3):

[0240] ACGGGTCGTGTCAAGGTTCTGGACTGCCTCCAA;

[0241] Internal primer BIP (SEQ ID No.4):

[0242] CGTCCATCTTGGCGATGTTGGGAATCCCCATGTTCA;

[0243] Loop primer LF (SEQ ID No.5): CCGGAGCCAATGACCT;

[0244] Loop primer LB (SEQ ID No. 6): CTCAATCGGTCCATGC.

[0245] The primer set used to detect Mucorella umbelliferus is as follows (5'→3'):

[0246] Outer primer F3 (SEQ ID No.7): GGGTAAAAAAGGTGGATG;

[0247] Outer primer B3 (SEQ ID No.8): CATTGGATCCCTTTTTC;

[0248] Internal primer FIP (SEQ ID No.9):

[0249] CCAAGAGGTGAGGTTGGGATGTTGCCTCTTCAGCT...

Embodiment 2

[0278] The specificity of embodiment 2 mucormycetes primer combinations

[0279] 1. Preparation of samples to be tested

[0280] Test sample 1: Rhizopus oryzae plasmid

[0281] Test sample 2: Mucorella umbelliferum plasmid

[0282] Test sample 3: Plasmid of Mucor circiniferans

[0283] Sample to be tested 4: Rhizomucor micromus plasmid

[0284] Rhizopus oryzae detection gene plasmid: Insert the DNA molecule with Genebank number AB167714.1 between the MCS of the pEasy-blunt plasmid (Beijing Quanshijin Biotechnology Co., Ltd.) to obtain a recombinant plasmid, which is rice root Mold detection gene plasmid.

[0285] Mucorella umbellatus detection gene plasmid: Insert a DNA molecule with a Genebank number of GQ342716.1 between the MCSs of the pEasy-blunt plasmid (Beijing Quanshijin Biotechnology Co., Ltd.) to obtain a recombinant plasmid, which is the umbrella Mucoral spp. detection gene plasmid.

[0286] Mucor crimperida detection gene plasmid: Insert a DNA molecule with Ge...

Embodiment 3

[0299] Example 3 Mucorales fungi identify the sensitivity of the primer combination

[0300] Sample 1 to be tested: the Rhizopus oryzae gene plasmid DNA to be tested in Example 2.

[0301] Sample 2 to be tested: the gene plasmid DNA of Mucor umbelliferum to be tested in Example 2.

[0302] Test sample 3: the test gene plasmid DNA of Mucor circiniferans of Example 2.

[0303] Sample 4 to be tested: the Rhizomucor pumilii test gene plasmid DNA of Example 2.

[0304] 1. The plasmid DNA of the gene to be tested is serially diluted with sterile water to obtain each dilution.

[0305] 2. Using the dilution obtained in step 1 as a template, respectively use the primer set I, primer set II, primer set III or primer set IV prepared in Example 1 to perform loop-mediated isothermal amplification.

[0306] When the sample to be tested is the sample to be tested 1, the loop-mediated isothermal amplification is performed using primer set I. When the sample to be tested is the sample to be...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnology, in particular to a primer set and its application. The invention discloses a combination of LAMP primers for four kinds of fungi of Mucorales and its application. The primer combination provided by the present invention is composed of 24 primers shown in SEQ ID No.1-24. The combination of primers provided by the present invention can be applied to detect whether Rhizopus oryzae, Mucorus umbellatus, Mucor circinosa and / or Rhizomucor minimus are contained, and can be applied to detect whether Rhizopus oryzae or Mucorus umbellatus is contained in the sample to be tested. , Mucor circiniferans and / or Rhizomucor micromus. The primer combination provided by the invention is used to identify four fungi of the order Mucorales, has high specificity and high sensitivity, and can realize simple, rapid and accurate detection. The invention has great popularization value.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a primer set and its application. Background technique [0002] Invasive fungal disease (IFD), also known as invasive fungal infection (IFI) or deep fungal infection (DFI), refers to the invasion of fungi into human tissues and blood, where they grow and reproduce. A pathophysiological process that causes an inflammatory response and leads to tissue damage and organ dysfunction. In the past 20 to 30 years, with the wide application of new technologies such as solid organ and hematopoietic stem cell transplantation, tumor chemotherapy, and immunosuppressants, the morbidity and mortality of invasive fungal diseases have increased year by year, and it has increasingly become the leading cause. One of the leading causes of death in hospitalized patients. Invasive mycoses usually occur in the ICU, advanced age, diabetes, malignant blood system diseases, Candida colonization, invasive op...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/6895C12Q1/6844C12Q1/04
Inventor 张岩王颢婷高占成邢婉丽陈燕旌程京
Owner CAPITALBIO CORP
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More