Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of mthfd1 inhibitors in inhibiting and killing viruses

A technology of inhibitors, viruses, applied in the field of medicine

Active Publication Date: 2021-11-26
TSINGHUA UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no research report on the antiviral effect of MTHFD1

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of mthfd1 inhibitors in inhibiting and killing viruses
  • Application of mthfd1 inhibitors in inhibiting and killing viruses
  • Application of mthfd1 inhibitors in inhibiting and killing viruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0124] Materials and methods

[0125] 1. Construction of MTHFD1 knockout cell lines

[0126] 1.1. Construction of sgRNA expression vector

[0127] sgRNA primer sequence:

[0128] sgMTHFD1-1 forward primer: 5′-caccgAAGGGGAGTGGATCAAACCT-3′;

[0129] sgMTHFD1-1 reverse primer: 5′-aaac AGGTTTGATCCACTCCCCTT c-3′;

[0130] sgMTHFD1-2 forward primer: 5′-caccgGAGGTTATTAGCTGCAGTGA-3′;

[0131] sgMTHFD1-2 reverse primer: 5'-aaac TCACTGCAGCTAATAACCTC c-3'.

[0132] The synthetic sgRNA primer sequence was treated with T4 polynucleotide kinase at 37°C for 30 minutes to phosphorylate it, denatured at 95°C for 5 minutes, and annealed at 1.5°C / min to 25°C to obtain BsmBI (or BbsI) Double-stranded DNA fragments with cohesive ends, as follows:

[0133] Forward: 5′-CACCGNNNNNNNNNNNNNNNNNNNNN;

[0134] Reverse: CNNNNNNNNNNNNNNNNNNNNCAAA-5′.

[0135] The phosphorylation, denaturation and annealing system is:

[0136] 1 μl 100 μM forward oligonucleotide strand;

[0137] 1 μl 100 μM revers...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of medicine, and specifically discloses the application of MTHFD1 inhibitors in inhibiting and killing viruses. The present invention finds through experiments that MTHFD1 is a potential broad-spectrum antiviral target, and its inhibitors (especially carolacton and its derivatives) can effectively and broad-spectrum inhibit viruses (such as influenza virus, coronavirus, mumps virus, Zika virus, etc.) Viruses, etc.) proliferation, can have a very good application prospect in the field of anti-virus.

Description

technical field [0001] The invention relates to the technical field of medicine, in particular to the application of MTHFD1 inhibitors (especially carolacton and its derivatives) in inhibiting and killing viruses. Background technique [0002] Many important infectious diseases that humans suffer from are caused by viruses. These diseases include rabies, smallpox, poliomyelitis, hepatitis, pneumonia, yellow fever, immunodeficiency and various encephalitic diseases, many of which are highly contagious and produce acute discomfort, often fatal, others Diseases such as rubella and cytomegalovirus can cause birth defects. Coronavirus is a large family of viruses known to infect the upper respiratory tract and gastrointestinal tract of mammals and birds, which can cause colds and Middle East Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome (Severe Acute Respiratory Syndrome, SARS) and other serious diseases. [0003] On February 10, 2020, the Coronavirus Resea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K45/00A61P31/12A23L33/10A61K31/365A01N43/22A01P1/00
CPCA01N43/22A23V2002/00A61K31/365A61K45/00A23L33/10A61P31/12A23V2200/30Y02A50/30
Inventor 谭旭崔进谭文杰黄保英
Owner TSINGHUA UNIV