Fusion gene of RARA related variant APL as well as detection primer and application of fusion gene
A fusion gene and mutation technology, applied in the field of clinical diagnosis, can solve problems such as poor prognosis, insensitivity or tolerance to ATRA treatment, and poor overall treatment effect, so as to expand the detection range and improve the detection rate and accuracy.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1: Verification and Analysis for Cases with Definite Diagnosis
[0028] The patient, male, 50 years old, was admitted to the First Affiliated Hospital of Jiangsu University due to "sudden headache, nausea, and blurred vision for 15 hours". Blood routine examination showed white blood cells 15.54×10 9 / L, hemoglobin 75g / L, platelet 62×10 9 / L. Hemagglutination test showed plasma prothrombin time (PT) was 14.7sec (10.5-13.0sec), activated partial thromboplastin time (APTT) was 24.9sec (ref.23-35sec), fibrinogen level was 0.9g / L (ref.2.00-4.00g / L), D-dimer level was 3.830μg / mL (ref.0.00-0.55μg / mL). Bone marrow morphology showed that the bone marrow hyperplasia was obviously active, the granule-red ratio was 15.73:1, and the granulocytes were abnormally hyperplastic, with pathological promyelocytosis accounting for 84.5%. Plasma, the inner pulp is covered with dense azurphagous granules, mainly fine particles, relatively uneven, and nucleoli are faintly visible. ...
Embodiment 2
[0030] Embodiment 2: Amplification test
[0031] For the case of TNRC18 exon5-RARA exon3 new fusion gene detected by high-throughput sequencing RNA-seq in Example 1, the primers designed by the present invention were used for verification, and the target genes designed by the upstream primers were all selected from the nucleus shown in SEQ ID NO.11 Nucleotide sequence (i.e. TNRC18 exon5), the target gene designed by the downstream primer is selected from the nucleotide sequence shown in SEQ ID NO.12 (i.e. RARA exon3) or its downstream RARA exon4 and RARA exon5 sequences and RARA exon6 sequences, the design principles are the same , the primer sequences are shown in Table 1 below (1 and 2 are a pair of primers, 3 and 4 are a pair of primers, and so on);
[0032] Table 1
[0033] SEQ ID Sequence (5'——3') NO.1 GCCCAGGGTGAGGCAGAAGT NO.2 CCCATAGTGGTAGCCTGAGGACTT NO.3 GTCGCTGCCTCCTCCTCCAA NO.4 TCGGTCGTTTCTCACAGACTCCTT NO.5 ACTCGGTCATCC...
Embodiment 3
[0042] Embodiment 3: detect for control group cases
[0043] A total of 30 typical APL cases with definite diagnosis were selected, that is, in addition to the clinical manifestations of these cases, the PML / RAR fusion gene was detected in addition to the diagnosis of APL. These 30 cases were respectively numbered as C1-C30, and as the control group cases, the primer combinations 1 and 2 in Table 1 of the present invention were used for detection. The RNA extraction, reverse transcription PCR and sequencing methods were the same as in Example 2, and the results are shown in Table 2.
[0044] Table 2
[0045]
[0046]
[0047] At the same time, take the sample of the case (P1) of Example 1 and mix it with the sample of the control group numbered C1, and carry out doubling dilution. Dilute the sample, use the combination of 1 and 2 primers in Table 1 of the present invention to detect, RNA extraction, reverse transcription PCR and sequencing methods are the same as in Exa...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More