Fabric and home care products

a technology for home care and fabric, applied in the field of fabric and home care products, can solve problems such as difficulty in delivering consumer-acceptable benefits

Inactive Publication Date: 2014-07-10
PROCTER & GAMBLE CO
View PDF2 Cites 25 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patent is about adding cold water proteases to fabric and home care products to improve their cleaning and freshness. These proteases can be made by changing parts of parent enzymes like BPN' subtilisin and subtilisin from Bacillus lentus.

Problems solved by technology

However, given the sustainability and consumer trends to lower wash temperatures it is proving increasingly difficult to deliver consumer acceptable benefits and there remains a need to improve the cleaning and freshness profile of these laundry detergent compositions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fabric and home care products
  • Fabric and home care products
  • Fabric and home care products

Examples

Experimental program
Comparison scheme
Effect test

example 1

Assays

[0346]Various assays were used as set forth below. Any deviations from the protocols provided below are indicated in the subsequent Examples.

[0347]A. TCA Assay for Protein Content Determination in 96-Well Microtiter Plates

[0348]For BPN′ and BPN′ variants, this assay was started using filtered B. subtilis bacterial culture supernatant from microtiter plates grown 3-4 days at 33-37° C. with shaking at 230-250 rpm and humidified aeration. A fresh 96-well flat bottom microtiter plate (MTP) was used for the assay. First, 100 μL / well of 0.25 N HCl was placed in each well. Then, 25 μL of filtered culture broth was added. The light scattering / absorbance at 405 nm (use 5 sec mixing mode in the plate reader) was then determined in order to provide the “blank” reading. For the test, 100 μL / well of 30% (w / v) trichloroacetic acid (TCA) was placed in the plates and incubated for 10 minutes at room temperature. The light scattering / absorbance at 405 nm (use 5 sec mixing mode in the plate rea...

example 2

Construction of BPN′ Library and Cleaning Performance of BPN′ Variants

[0363]a) Description of the BPN′-v3 Expression Cassette Used for Library Construction

[0364]The BPN′-v3 (BPN′ protease containing G097A-G128A-Y217Q substitutions) expression cassette used for combinatorial library construction was generated using the BPN′ expression cassette, which comprises the aprE-BPN′ hybrid leader sequence (i.e., signal sequence), BPN′ pro and BPN′ mature sequence from B. amyloliquefaciens. The DNA sequence is shown below as SEQ ID NO:1 and encodes the BPN′ precursor protein shown below as SEQ ID NO:168.

(SEQ ID NO: 1)GTGAGAAGCAAAAAATTGTGGATCAGTTTGCTGTTTGCTTTAGCGTTAATCTTTACGATGGCGTTCGGCAGCACATCCTCTGCCCAGGCGGCAGGGAAAT

[0365]In the nucleotide sequence of SEQ ID NO:1, the DNA sequence encoding the mature protease is shown in bold, the nucleotide sequence encoding leader sequence (aprE-BPN′ hybrid leader sequence) is shown in standard (non-underlined) text, and the nucleotide sequence encoding the p...

example 3

Generation of Combinatorial Libraries and Cleaning Performance of Variants of BPN′-v3+S78N

[0379]a) Description of BPN′-v3+S78N Variant and Synthetic Gene Sequences Derived from this Variant

[0380]Gene Oracle synthesized and cloned eight genes into the pHPLT-BPN′-v3+S78N (BPN′-S78N-G97A-G128A-Y217Q) parent plasmid (see FIG. 2). Some of these genes were used as templates (parents) to create combinatorial libraries. The BPN′-v3+S78N variant was generated using standard molecular biology methods known in the art. The nucleotide sequence encoding the BPN′-v3+S78N variant is that of SEQ ID NO:7 and the amino acid sequence of the BPN′-v3+S78N variant is that of SEQ ID NO:8. The nucleotide and protein sequences of genes GcM90-96, and GcM100 are shown below.

GenesNucleotide SequenceProtein SequenceGcM90SEQ ID NO: 9SEQ ID NO: 10GcM91SEQ ID NO: 11SEQ ID NO: 12GcM92SEQ ID NO: 13SEQ ID NO: 14GcM93SEQ ID NO: 15SEQ ID NO: 16GcM94SEQ ID NO: 17SEQ ID NO: 18GcM95SEQ ID NO: 19SEQ ID NO: 20GcM96SEQ ID NO...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pHaaaaaaaaaa
conductivityaaaaaaaaaa
conductivityaaaaaaaaaa
Login to View More

Abstract

This invention relates to fabric and home care products comprising one or more cold water proteases and processes for making and using such products. Such compositions provide improved cleaning and freshness. Such cold water proteases may be derived from parent enzymes, including BPN′ subtilisin and subtilisin derived from Bacillus lentus, by substitution, insertion and / or deletion of one or more of the parent enzymes' amino acids.

Description

FIELD OF INVENTION[0001]This invention relates to fabric and home care products comprising cold water proteases as well as methods of making and using such fabric and home care products.BACKGROUND OF THE INVENTION[0002]Detergent manufacturers incorporate proteases into their products to provide good cleaning of stains (such as blood). However, given the sustainability and consumer trends to lower wash temperatures it is proving increasingly difficult to deliver consumer acceptable benefits and there remains a need to improve the cleaning and freshness profile of these laundry detergent compositions. The Inventors have found that additionally incorporating certain cold water proteases into a fabric and home care products, for example, a laundry detergent composition that comprises a hueing agent, a cleaning polymer and / or a perfume capsule, improves the whiteness, whiteness perception, and / or freshness.SUMMARY OF THE INVENTION[0003]This invention relates to fabric and home care produ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C11D3/386
CPCC11D3/38618C11D3/38609C11D3/38681C12N9/50
InventorSOUTER, PHILIP FRANKWARD, GLENN STEVENALEKSEYEV, VIKTOR YURYEVICHBASLER, JOSHUA ROYCASAO-PEREIRA, LUIS GUSTAVOESTELL, DAVID APOULOSE, AYROOKARAN JKELLIS, JR., JAMES TPISARCHIK, ALEXANDERTORRES-PAZMINO, DANIEL
OwnerPROCTER & GAMBLE CO