Methods and compositions for targeting polyubiquitin

a polyubiquitin and polyubiquitin technology, applied in the field of antipolyubiquitin antibodies, can solve the problems of affecting the normal physiological behavior of the lysine-linked polyubiquitin, affecting the normal cellular proteolytic processing system, and each of the methodologies is ill-suited or cumbersome for analysis of normal physiological behavior,

Active Publication Date: 2010-07-27
GENENTECH INC
View PDF2 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

These antibodies enable the selective targeting and modulation of polyubiquitin-mediated pathways, facilitating the analysis and treatment of diseases associated with ubiquitin dysregulation, including cancer, neurological disorders, and immune-inflammatory disorders.

Problems solved by technology

Other lysine-linked polyubiquitins have not been studied extensively, largely because of the difficulty in distinguishing between them.
Each of those methodologies is ill-suited or cumbersome for analysis of the normal physiological behavior of particular lysine-linked polyubiquitins.
A mutant form of ubiquitin has been identified in the brains of Alzheimer's patients that is very efficiently incorporated into polyubiquitin chains, but is refractory to deubiquitination once formed, potentially leading to dominant inhibition of the normal cellular proteolytic processing system (Lam et al., Proc. Natl. Acad. Sci. 97: 9902-9906 (2000)).

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods and compositions for targeting polyubiquitin
  • Methods and compositions for targeting polyubiquitin
  • Methods and compositions for targeting polyubiquitin

Examples

Experimental program
Comparison scheme
Effect test

example 1

Isolation and Characterization of First Generation Anti-polyubiquitin Antibodies

[0387]A) Library Sorting

[0388]Phage from naïve antibody libraries were subjected to binding selection against immobilized synthetic peptides including an isopeptide bond mimicking either K48-linked polyubiquitin or K63-linked polyubiquitin. No enrichment was observed after six rounds of selection. The synthetic peptides were lengthened, and the naïve antibody libraries were again screened. Once again, no enrichment was observed after six rounds of binding selection.

[0389]Phage from the naive YS-B antibody library were subjected to four rounds of binding selection against polyubiquitin chains having different known ubiquitin isopeptide linkages. The YS-B antibody library contains randomized amino acids in all three heavy chain CDRs and light chain CDR3 (see U.S. Published Patent Application No. 2005-0106667), and is based on humanized antibody 4D5.

[0390]Enzymatically synthesized full-length K48-linked or ...

example 2

Isolation and Characterization of Second Generation Anti-polyubiquitin Antibodies

[0406]Second generation libraries for Fab display were constructed from the phagemids encoding the previously identified clones apu05 (K48-linked polyubiquitin-selective) and apu 18 (K63-linked polyubiquitin-selective) (see FIGS. 10 and 11). Phage from those clones were used to infect CJ236 cells to prepare Kunkel DNA templates. Those templates were subsequently mutagenized to insert stop codons, and the stop-containing templates were used in library construction as follows.

[0407]The Fab apu05 was mutagenized according to two different schemes to create two different apu05-derived libraries. In the first library, only HVR-H3 was mutagenized. HVR-H3 was first modified to include a stop codon in the Kunkel template, followed by a mutagenesis utilizing four mutagenic oligonucleotides. The stop codon-encoding oligonucleotide in all cases was CGTCTATTATTGTGCTCGCTAATAAGACTACTGGGGTCAAGG (SEQ ID NO: 365). The f...

example 3

Binding of Anti-polyubiquitin Antibodies to Endogenously Polyubiquitinated Proteins

[0427]Previous experiments had demonstrated that the activity of Receptor Interacting Protein (RIP), a 140 kD essential mediator of the proximal TNF receptor 1 (TNFR1) signaling complex, is modulated by polyubiquitination (Wertz et al., Nature 430: 694-699 (2004)). When RIP is polyubiquitinated with K63-linked polyubiquitin chains, signaling through TNFR1 is facilitated. Removal of the K63-linked polyubiquitin chains from RIP by the de-ubiquitinating N-terminus of A20 and replacement with K48-linked polyubiquitin chains by the ubiquitin ligase function of the A20 C terminus inactivates RIP and targets it for proteasomal degradation. That mechanism had been elucidated using cell lines expressing mutant ubiquitin capable of forming only K48-linked or K63-linked polyubiquitin.

[0428]The ability of two of the anti-K48 and anti-K63-linked polyubiquitin binding proteins of the invention to specifically recog...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
binding affinityaaaaaaaaaa
affinityaaaaaaaaaa
Login to View More

Abstract

Anti-polyubiquitin monoclonal antibodies, and methods for using the antibodies, are provided.

Description

RELATED APPLICATIONS[0001]This application claims priority under 35 U.S.C. §119(e) to U.S. provisional application No. 60 / 751,081, filed Dec. 15, 2005, and to U.S. provisional application No. 60 / 793,980, filed Apr. 21, 2006, the contents of which are incorporated in their entirety herein by reference.FIELD OF THE INVENTION[0002]This invention relates to the field of anti-polyubiquitin antibodies, and more particularly to anti-polyubiquitin antibodies that do not specifically bind to monoubiquitin and that can discriminate between polyubiquitins having different isopeptide linkages.BACKGROUND[0003]Ubiquitin is a small protein that has important regulatory roles in a wide variety of cellular pathways. The best known of these is ubiquitin's role in protein degradation, where covalent attachment of ubiquitin to a target protein enables that target protein to be recognized and destroyed by the 26S proteasome (see Wilkinson, Semin. Cell Devel. Biol. 11(3): 141-148 (2000)). Protein kinase ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(United States)
IPC IPC(8): A61K39/00
CPCC07K16/18C07K2317/32C07K2317/92C07K2317/565C07K2317/55A61P11/00A61P21/00A61P21/02A61P21/04A61P25/00A61P25/16A61P25/28A61P29/00A61P35/00A61P35/02A61P37/00A61P43/00A61K39/395C07K16/00C07K16/005
InventorGORDON, NATHANIEL C.KELLEY, ROBERT F.PHAM, ANH
OwnerGENENTECH INC