Method for constructing HSV-1 BAC system carrying luciferase report genes

A technology of HSV-1 BAC and luciferase, which is applied in the field of construction of HSV-1 BAC system, can solve problems such as difficulty in separation and purification of recombinant viruses, mutations, and loss of essential genes

Inactive Publication Date: 2012-08-29
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional homologous recombination method is difficult to obtain virus mutants, and it is impossible to delete or mutate essential genes. Therefore, cloning the whole genome of HSV-1 into bacterial artificial chromosomes can carry out the transformation of the virus genome in E. coli and improve the construction of recombination. The efficiency of the virus, which will establish a good technical platform for basic and applied research on HSV-1
Some BAC infectious clones of HSV-1 have been reported in previous studies, but some virus genes were inactivated due to the insertion of the BAC backbone, and some lacked suitable selection markers, which made subsequent isolation and purification of recombinant viruses difficult. difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing HSV-1 BAC system carrying luciferase report genes
  • Method for constructing HSV-1 BAC system carrying luciferase report genes
  • Method for constructing HSV-1 BAC system carrying luciferase report genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] A kind of construction method of the HSV-1 BAC system that carries luciferase reporter gene, its steps are:

[0080] 1. Build HSV-1 BAC system:

[0081] (1) Design primers containing HSV-1 UL37 and UL38 homology arms and BAC vector sequences based on the HSV-1 F strain sequence (Accession no.GU734771). The UL37 and UL38 arms contain two loxP sites on both sides, and a Bam HI restriction site. (Lowercase letters indicate restriction sites, and italics indicate protective bases)

[0082] UL37 forward: TA ggatcc GAGCTGCAGCAGGCTGGAG

[0083] UL37 reverse: CCG aagctt ATAACTTCGTATAGCATACATTATACGAAGTTATAAGTGGCCG

[0084] TATAACACCC

[0085] UL38 forward: CGC aagctt ATAACTTCGTATAATGTATGCTATACGAAGTTATAAGTCCCGG

[0086] CATCCCGTTCG

[0087] UL38 reverse: AT ggatcc GCCCAAACAGCCGCTCCAG;

[0088] (2) Construction of transfer vector pUSF6:

[0089] 1) Use the high-fidelity enzyme KOD and the above primers to PCR amplify the UL37 and UL38 arms, and recover th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing an HSV-1 BAC (herpes simplex virus I bacterial artificial chromosome) system carrying luciferase report genes. The method comprises the following steps of: A, constructing a system, namely (1) designing primers according to HSV-1 F strain sequences, (2) constructing transfer vectors, (3) constructing recombinant viruses, (4) purifying plaques, (5)identifying the recombinant viruses, (6) constructing recombinant BAC, (7) saving the recombinant viruses and (8) measuring a growth curve; and B, constructing a Luciferase stable expression system, namely (1) designing amplified Luciferase-Hygr primers, (2) amplifying fragments by using high-fidelity KOD enzyme, (3) electrically transforming pHSV-1 BAC to E.coliDY380, (4) electrically transforming the reclaimed DNA fragments into pHSV-1 BAC / DY380 electrically-transformed competent cells, (5) identifying, (6) picking DY380 monoclone, (7) extracting BAC plasmids, (8) saving the viruses, and (9) performing half quantification on the viruses in vitro for the HSV-1 BAC Luc recombinant virus infected cells. The method is simple, feasible and convenient to operate, can modify the virus genomes in vitro, and also can perform half quantification on the virus particles in vitro.

Description

technical field [0001] The invention belongs to the fields of molecular biology and virology. More specifically relate to the construction method of a kind of novel HSV-1 BAC system carrying luciferase reporter gene. This new HSV-1 reverse genetic operating system can be used to quickly and accurately transform the virus genome in Escherichia coli, and at the same time, it can conveniently and quickly semi-quantify the virus in vitro. It has laid a solid foundation for the research of proteomics and the establishment of HSV-1 gene therapy and high-efficiency vaccine virus vector system. Background technique [0002] Herpesviruses are a large class of double-stranded linear DNA viruses with an envelope, with a genome size of about 125-245 kb, which can infect humans and various animals. Herpesviridae includes more than 110 kinds of viruses, which can be divided into α, β, and γ subfamilies according to their biological characteristics and clinical pathogenic characteristic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/63C12N15/65C12N15/38C12N7/01C12Q1/70C12Q1/66
Inventor郑春福李友
OwnerWUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI