HIV (Human Immunodeficiency Virus) subtype detection gene chip based on total genomic probe
A technology for detecting gene chips and whole genomes, applied in the field of detection, can solve the problems of high requirements, expensive equipment, expensive sequencing costs, etc., and achieve low cost, accurate and reliable results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] The preparation of embodiment 1 oligonucleotide probe
[0031] 1. Probe Design
[0032] According to the international HIV database http: / / www.hiv.lanl.gov, the HIV reference full gene sequence of various genotypes is obtained, and the ClustalX 1.83 gene sequence is used for comparison to find out the intra-species conserved region and inter-species in the target gene Specific region, and then use Primer premier 5.0 software to design probes in this region. The probe sequences are listed in Table 1. The design of the probes should follow the following principles: (1) The Tm value difference between the probes should not exceed 5°C, and the length of the probes should not exceed 25 bases; (2) The G+C content of the probes should be between 40-60 %; (3) Avoid more than 5 repeated bases.
[0033] Table 1 Probe sequence:
[0034] SEQ ID Probe No. Subtype sequence (5'-3') No: 1 OA-3468 O GGTCCAATGGCCTGGTACAGCATGG No: 2 OA-3469 O GGCTTT...
Embodiment 2
[0036] The preparation of embodiment 2 gene chip
[0037] (2) Chip point system
[0038] Firstly, dissolve the synthesized probe dry powder tube. Centrifuge at 12000rpm for 5min, add 50% DMSO (14μl to 1OD), mix with a shaker and centrifuge quickly to remove the liquid on the tube wall. Place it at room temperature for 1 hour, take 1 μl and dilute it 180 times with 50% DMSO, measure its absorbance value, and convert it into mass concentration (ng / μl), and finally dilute the probe to a final concentration of 1 μg / μl. The formula for calculating the volume to add 50% DMSO is as follows:
[0039]
[0040] Add the probes to the corresponding positions in the 384-well plate, and add 10 μl of probes to each well. The probes in the 384-well plate were spotted onto the glass slides (formylated slides were purchased from Beijing Boao Biological Co., Ltd.) using an automatic spotting instrument. Use the SpotArray Microarray Spotting System gene chip spotting instrument (model Spot...
Embodiment 3
[0041] Example 3 Genome-wide probe hybridization detection method for HIV genotyping
[0042] 1. Design of PCR amplification primers
[0043] Referring to the full-length gene sequences of various gene subtypes in the international HIV database http: / / www.hiv.lanl.gov, divide the full-length HIV sequence into three segments, use Primer Premier5.0 to design and screen, and design two pairs of primer nests respectively PCR amplification, a total of 6 pairs of primers, the sequences of the 6 pairs of primers are shown in Table 2.
[0044] Table 2 Primer sequences:
[0045]
[0046] 2. Prepare the DNA of the sample to be tested
[0047] The blood sample to be tested was positive for HIV, and genomic DNA was extracted from the whole blood using Qiagen's whole blood DNA extraction kit according to the instructions.
[0048] 3.PCR amplification
[0049] rTaq and dNTPase were purchased from TAKARA Company, and dNTP Mixture was purchased from Invitrogen Company.
[0050] With the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 