Unlock instant, AI-driven research and patent intelligence for your innovation.

HIV (Human Immunodeficiency Virus) subtype detection gene chip based on total genomic probe

A technology for detecting gene chips and whole genomes, applied in the field of detection, can solve the problems of high requirements, expensive equipment, expensive sequencing costs, etc., and achieve low cost, accurate and reliable results

Inactive Publication Date: 2012-12-26
PEOPLES REPUBLIC OF CHINA BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The most classic method for detecting HIV subtypes is gene sequencing analysis, which has the following obvious limitations: (1) High technical difficulty and high requirements: in this method, whether it is gene amplification, gene sequencing or bioinformatics analysis, It needs very professional high-end technicians to complete, and it can only be completed in a few high-end laboratories
(2) The equipment is expensive and the detection cycle is long. Gene sequencers generally cost more than 2 million yuan, and a complete analysis cycle takes at least two weeks
(3) It is difficult to analyze the whole gene sequence: due to the high cost of sequencing and cycle problems, HIV subtype analysis is generally carried out by measuring partial gene fragments. completely accurate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HIV (Human Immunodeficiency Virus) subtype detection gene chip based on total genomic probe
  • HIV (Human Immunodeficiency Virus) subtype detection gene chip based on total genomic probe
  • HIV (Human Immunodeficiency Virus) subtype detection gene chip based on total genomic probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] The preparation of embodiment 1 oligonucleotide probe

[0031] 1. Probe Design

[0032] According to the international HIV database http: / / www.hiv.lanl.gov, the HIV reference full gene sequence of various genotypes is obtained, and the ClustalX 1.83 gene sequence is used for comparison to find out the intra-species conserved region and inter-species in the target gene Specific region, and then use Primer premier 5.0 software to design probes in this region. The probe sequences are listed in Table 1. The design of the probes should follow the following principles: (1) The Tm value difference between the probes should not exceed 5°C, and the length of the probes should not exceed 25 bases; (2) The G+C content of the probes should be between 40-60 %; (3) Avoid more than 5 repeated bases.

[0033] Table 1 Probe sequence:

[0034] SEQ ID Probe No. Subtype sequence (5'-3') No: 1 OA-3468 O GGTCCAATGGCCTGGTACAGCATGG No: 2 OA-3469 O GGCTTT...

Embodiment 2

[0036] The preparation of embodiment 2 gene chip

[0037] (2) Chip point system

[0038] Firstly, dissolve the synthesized probe dry powder tube. Centrifuge at 12000rpm for 5min, add 50% DMSO (14μl to 1OD), mix with a shaker and centrifuge quickly to remove the liquid on the tube wall. Place it at room temperature for 1 hour, take 1 μl and dilute it 180 times with 50% DMSO, measure its absorbance value, and convert it into mass concentration (ng / μl), and finally dilute the probe to a final concentration of 1 μg / μl. The formula for calculating the volume to add 50% DMSO is as follows:

[0039]

[0040] Add the probes to the corresponding positions in the 384-well plate, and add 10 μl of probes to each well. The probes in the 384-well plate were spotted onto the glass slides (formylated slides were purchased from Beijing Boao Biological Co., Ltd.) using an automatic spotting instrument. Use the SpotArray Microarray Spotting System gene chip spotting instrument (model Spot...

Embodiment 3

[0041] Example 3 Genome-wide probe hybridization detection method for HIV genotyping

[0042] 1. Design of PCR amplification primers

[0043] Referring to the full-length gene sequences of various gene subtypes in the international HIV database http: / / www.hiv.lanl.gov, divide the full-length HIV sequence into three segments, use Primer Premier5.0 to design and screen, and design two pairs of primer nests respectively PCR amplification, a total of 6 pairs of primers, the sequences of the 6 pairs of primers are shown in Table 2.

[0044] Table 2 Primer sequences:

[0045]

[0046] 2. Prepare the DNA of the sample to be tested

[0047] The blood sample to be tested was positive for HIV, and genomic DNA was extracted from the whole blood using Qiagen's whole blood DNA extraction kit according to the instructions.

[0048] 3.PCR amplification

[0049] rTaq and dNTPase were purchased from TAKARA Company, and dNTP Mixture was purchased from Invitrogen Company.

[0050] With the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an HIV (Human Immunodeficiency Virus) subtype detection gene chip based on a total genomic probe, comprising a solid phase vector and an oligonucleotide probe fixed on the solid phase vector, wherein the oligonucleotide probe is sequences of SEQ ID No:1-No:75 shown as in a sequence table. The gene chip can be used for determining a gene subtype of the HIV simply, conveniently, quickly and more accurately.

Description

technical field [0001] The invention belongs to the technical field of detection, and in particular relates to a gene chip for detecting HIV subtypes based on a whole genome probe. Background technique [0002] Human immunodeficiency virus (HIV) has a high degree of genetic variability, and can be divided into HIV-1 and HIV-2 types according to the differences in their gene sequences. HIV-1 is currently the most prevalent in the world. HIV-1 is further divided into 3 groups: M group, 0 group and N group. The M group can be divided into A-D, F-H and J, K9 gene subtypes, and there are more than 34 prevalent recombinant types (CRF). So far, 8 subtypes of A, B', B, C, D, B / C (CRF07-BC, CRF08-BC), CRF01-AE, and CRF02-AG have been identified among infected persons in my country. The genotyping of HIV was initially determined based on the gene sequence analysis of the membrane region (env), and later the gag region was also used as the basis for HIV typing. With the acquisition...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 刘建礼朱红张绍福
Owner PEOPLES REPUBLIC OF CHINA BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU