Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for evaluating unintended effect of molecular level of transgenic plant

A technology of transgenic plants and unexpected effects, applied in the field of molecular biology, can solve problems such as conclusion uncertainty, and achieve the effect of mature technology, simple and easy operation

Inactive Publication Date: 2011-11-23
PEKING UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the middle of this process, there is uncertainty in the conclusion caused by the "black box" of each pathway chain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for evaluating unintended effect of molecular level of transgenic plant
  • Method for evaluating unintended effect of molecular level of transgenic plant
  • Method for evaluating unintended effect of molecular level of transgenic plant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027]An example of an unintended effect study on the molecular level of Bt transgenic rice.

[0028] 1. Cloning and identification of foreign protein Bt gene

[0029] Analyze the sequence of the target gene fragment and the multi-cloning site information of the ligated vector, and design the following primers:

[0030] 5' primer: CC CATATG ATGGATAACAATCCGAACATC, the underlined part is the introduced Nde I restriction site;

[0031] 3' primer: GC GTCGAC ATCATATTCTGCCTCAAAGG, the underlined part is the introduced SalI restriction site;

[0032] The Bt gene fragment was obtained by PCR of Bacillus thuringiensis HD-1 strain (purchased from the Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences). 50 μL PCR system: 1 μL of 5’ primer, 1 μL of 3’ primer, 5 μL of 10×KOD buffer, MgSO 4 buffer 2μL, dNTP 5μL, KOD plus enzyme 1μL, ddH 2 O 35μL; PCR conditions: 94°C for 5min, 94°C for 30sec, 58°C for 30sec, 72°C for 2min, 39 cycles, and 72°C for 10min...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for evaluating the unintended effect of the molecular level of a transgenic plant based on a yeast two hybrid technology. The method comprises the following steps of: constructing an extraneous target protein as a bait fusion protein; constructing a cDNA (complementary Deoxyribonucleic Acid) library of a transgenic plant receptor parent as a prey fusion protein; and screening a prey fusion protein library with the prey fusion protein by adopting a yeast two hybrid method to obtain a positive cistron interacting with the extraneous target protein. According to the method, evaluation of the unintended effect of the molecular level of the transgenic plant is realized.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a method for evaluating the safety of transgenic plants, in particular to a method for evaluating the unintended effects at the molecular level of the transgenic plants. Background technique [0002] According to the definition of the United Nations Food and Agriculture Organization (FAO), biosecurity refers to "avoidance of risks to human health and safety and the protection of the environment due to the research and commercial production of infectious or genetically modified organisms", It can be classified into three aspects: ecological risk, food safety and unintended effects. Among many items of safety evaluation of transgenic plants, the evaluation of unintended effects is the most difficult item, because the unintended effects of transgenic plants are significantly unpredictable (European food safety authority, 2005; , 2004). According to the definition of the Food and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/02C12R1/19C12R1/645
Inventor 王戎疆许崇任韩娟甄刚
Owner PEKING UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More