Supercharge Your Innovation With Domain-Expert AI Agents!

Human paraoxonase (PON) 2 gene 148 site G/A polymorphic detection kit

A gene polymorphism and kit technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of high price of endonucleases, difficult to popularize and use, affecting costs, etc.

Inactive Publication Date: 2012-04-25
ZHENGZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the endonuclease Fnu4HI is often used to identify the human PON2 gene polymorphism rs12026. The price of this endonuclease is expensive (for the reference price of some endonucleases, please refer to the following Table 1), which affects the cost of the experiment and is difficult to use in the experiment. Universal use in the room
And due to the inherent defects of the traditional PCR-RFLP method, it is usually difficult for those skilled in the art to select other restriction endonucleases to identify the human PON2 gene polymorphism rs12026

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human paraoxonase (PON) 2 gene 148 site G/A polymorphic detection kit
  • Human paraoxonase (PON) 2 gene 148 site G/A polymorphic detection kit
  • Human paraoxonase (PON) 2 gene 148 site G/A polymorphic detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] 1 Materials and methods

[0075] 1.1 Main reagents and instruments

[0076] Reagents: 2×PCR mix (MBI Company), restriction endonuclease BsmAI (NEB Company), agarose (BBI Company), primers synthesized by Shanghai Sangon Company.

[0077] Instruments: Model 9600 PCR instrument (PE Company), mini electrophoresis tank (Pharmacia Biotech, EPS1000), Gel Doc 2000 gel imager (Bio-RAD Company).

[0078] PCR product sequencing was completed by Shanghai Sangon Bioengineering Co., Ltd.

[0079] 1.2 Sequence search and primer design

[0080] Search the PON2 gene sequence and SNP information on the NCBI website, determine the base variation information of the PON2 polymorphic site in combination with relevant literature, and design primers, as follows:

[0081] Forward primer 5' AGGTCCCGTAGTTATGTCTTGT 3' (SEQ ID NO: 1),

[0082] Reverse primer 5'TCAGATGCAACAGAGAATT G TCT 3' (SEQ ID NO: 2);

[0083] 1.3 Extract DNA from whole blood samples as DNA to be tested

[0084] Collect 3...

Embodiment 2

[0102] Example 2 Determination of human PON2 gene rs12026 polymorphism in peripheral blood whole blood samples:

[0103] The steps in Example 1 are basically the same, the forward primer used in the PCR reaction is SEQ ID NO: 7, the reverse primer is SEQ ID NO: 8, the annealing temperature is 57 ° C, and the restriction endonuclease used is Alw26I (MBI);

[0104] Forward primer: 5'TGCCCAGAGGTCCCGTAG 3' (SEQ ID NO: 7)

[0105] Reverse primer: 5′TTCAGATGCAACAGAGAATT G TCT 3' (SEQ ID NO: 8)

[0106] result:

[0107] The amplified sequence (its position corresponds to bases 168-325 in the partial gene sequence containing PON2 polymorphism rs12026, a total of 158bp), the obtained amplification product sequence is as follows (SEQ ID NO: 9):

[0108] tgcccagagg tcccgtag tt atgtcttgta aattaactct gttctttcaa ttctttagat 60

[0109] gacacagttt atctctttgt tgtaaaccac ccagaattca agaatacagt ggaaattttt 120

[0110] aaatttgaag aags agacaa ttctctgttg catctgaa ...

Embodiment 3

[0120] Example 3 Determination of peripheral blood clot specimen Determination of human PON2 gene rs12026 polymorphism:

[0121] The steps are basically the same as in Example 1, except that the following method is used to extract DNA from the peripheral blood clot specimen as the DNA to be tested. In addition, the forward primer used in the PCR reaction is SEQ NO: 12, the reverse primer is SEQ NO: 13, and the annealing temperature is 56°C.

[0122] Forward primer: 5'GTCCCGTAGTTATGTCTTGTAAA 3' (SEQ NO: 12)

[0123] Reverse primer: 5′CAGATGCAACAGAGAATTG TCT 3' (SEQ NO: 13)

[0124] DNA extraction:

[0125] Collect 400 μl of human peripheral blood in a common blood collection tube, and use the RelaxGene Blood DNA System blood genomic DNA extraction system from TIANGEN Company to extract the genomic DNA in the peripheral blood clot as the human genomic DNA template to be tested;

[0126] After the serum in the blood collection tube is separated out, separate the serum, and the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a human paraoxonase (PON) 2 gene 148 site G / A polymorphic detection kit. The detection kit comprises a forward primer and a reverse primer in a sequence near the amplified human PON2 gene polymorphic rs12026 site and a restriction enzyme, wherein the forward primer is shown in SEQ ID NO:12, the reverse primer is shown in SEQ ID NO:13, and the restriction enzyme is BsmAI. The invention has the advantages of simple operation process, low cost and wide operation range.

Description

[0001] This application is a divisional application of the invention patent application with the application number "200910227638.8", the application date is December 24, 2009, and the invention title is "Method for Identifying Human PON2 Gene Polymorphism rs12026". 1. Technical field [0002] The present invention relates to methods of identifying single nucleotide polymorphisms. More specifically, the present invention relates to a method for identifying the human PON2 gene polymorphism rs12026. 2. Background technology [0003] SNP (Single Nucleotide Polymorphism) refers to the DNA sequence variation caused by the change of a single nucleotide, including single base substitution, insertion and deletion. SNP has been widely used in genetic linkage analysis and association analysis of simple and complex diseases, as well as the location of disease susceptibility genes, and guides the cloning of susceptibility genes. Polymerase chain reaction-restriction fragment length pol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 杨永利姚武王威
Owner ZHENGZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More