Plant adversity-resistant related protein TaMYB30, coding gene and application thereof

A plant stress tolerance and coding technology, which is applied to the plant stress tolerance-related protein TaMYB30 and its coding gene and application field, can solve the problems of complex stress resistance mechanism of plants, achieve broad application and market prospects, and improve the effect of stress tolerance

Active Publication Date: 2012-10-17
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The mechanism of plant resistance to stress is very complex. Although traditional breeding methods have some effect on improving the stress resistance of crops, they are still far from the desired goal.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant adversity-resistant related protein TaMYB30, coding gene and application thereof
  • Plant adversity-resistant related protein TaMYB30, coding gene and application thereof
  • Plant adversity-resistant related protein TaMYB30, coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1, discovery of TaMYB30 protein and its coding gene

[0040] In order to study the function of wheat MYB gene in plant stress resistance, 60 genes encoding wheat MYB protein were screened from 30,000 non-redundant wheat full-length cDNA sequences sequenced in the laboratory by bioinformatics method. The expression patterns of 60 wheat MYB genes under stress conditions were studied by semi-quantitative PCR, and the genes induced by stress were screened out.

[0041] The protein shown in Sequence 1 of the sequence listing is named TaMYB30 protein, which consists of 732 amino acid residues. The gene encoding the TaMYB30 protein is named TaMYB30 gene, its open reading frame is shown in the sequence 2 of the sequence listing from the 162-2357th nucleotide at the 5' end (2196bp), and its full-length cDNA is shown in the sequence 2 of the sequence listing Its genomic DNA is shown in sequence 3 of the sequence listing.

Embodiment 2

[0042] Example 2, the expression pattern of TaMYB30 gene in different tissues and the expression pattern under drought stress conditions

[0043] 1. Expression pattern of TaMYB30 gene in different tissues

[0044] RNA was extracted from different tissues (roots, stems, leaves, pistils, anthers) of Chinese spring wheat at the flowering stage, and the expression level of TaMYB30 gene was detected by RT-PCR. The target fragment of RT-PCR was 271bp, and the primers used were as follows:

[0045] Upstream primer: 5'-TGTTGATCCCTATGAGAATG-3';

[0046] Downstream primer: 5'-AGCTTGAGCTGCATGAGTA-3'.

[0047] The expression patterns of TaMYB30 gene in different tissues are shown in figure 1 , are expressed in various tissues.

[0048] 2. Expression pattern of TaMYB30 gene under drought stress conditions

[0049] Chinese spring wheat at the two-leaf one-heart stage was treated with 16.1% PEG aqueous solution; the leaves were taken before (0h), 1 hour after treatment, 3 hours after tre...

Embodiment 3

[0053] Embodiment 3, the acquisition of transgenic plants and the identification of stress tolerance

[0054] 1. Using Gateway technology to construct overexpression vectors

[0055] 1. attB primer design

[0056] Primer Primer5.0 software was used to design primers for amplifying the coding region of TaMYB30 gene. According to the requirements of Gateway technology for constructing expression vectors, attB1 and attB2 recombination sites were added to the 5' ends of the upstream primer (F1) and downstream primer (R1), respectively. The designed primer sequences are as follows:

[0057] F1: 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCT GGATGGCGACCGGCCCCGAT-3';

[0058] R1: 5'- GGGGACCACTTTGTACAAGAAAGCTGGGT TCAAAGGCTATTAAGAAGA-3'.

[0059] In the upstream primer, the attB1 recombination site is underlined. In the downstream primers, the attB2 recombination site is underlined.

[0060] 2. Extract the total RNA of Chinese spring wheat and reverse transcribe it into cDNA.

[0061] 3....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant adversity-resistant related protein TaMYB30, a coding gene and an application of the plant adversity-resistant related protein TaMYB30. The protein provided by the invention is the following (a) or (b): (a) a protein composed of amino acid sequences shown in the sequence 1 in a sequence table; (b) a sequence 1-derived protein obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of the sequence 1, and related to the plant adversity resistance. The method provided by the invention is theoretically and practically significant for research on plant adversity-resistant molecular mechanism, seed selection of plant adversity-resistant variety and molecular breeding of plant adversity resistance, and an economic, quick and effective way for improving the plant adversity resistance is provided. The plant adversity-resistant related protein TaMYB30 can be widely applied to the agricultural field with wide prospect.

Description

technical field [0001] The invention relates to a plant stress tolerance-related protein TaMYB30, its coding gene and application. Background technique [0002] Water scarcity and soil salinization are serious facts facing global agricultural production. Due to frequent droughts, the average annual drought-affected area in my country is 327 million mu. With global warming, the drought will become more and more serious, and the area of ​​farmland threatened by drought may exceed 700 million mu. According to estimates, abiotic stresses such as drought, low temperature, and salinity have an impact on crop yields of up to 40%. Water shortages in major grain-producing areas in northern my country reduce yields by 70-80 billion kilograms each year; Frequent occurrence, for example, the drought-affected area of ​​Guangdong every year exceeds 7.5 million mu; the drought-affected area of ​​crops in Sichuan Province in 2006 reached 21 million mu, accounting for 35% of the sown area, w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N5/10C12N1/21C12N15/82C12N15/84A01H5/00
Inventor孔秀英张立超赵光耀贾继增刘旭
OwnerINST OF CROP SCI CHINESE ACAD OF AGRI SCI