Kit for detecting stomach cancer inheritance risk
A kit and gastric cancer technology, applied in the field of molecular biology, can solve the problems of inability to mediate the detoxification effect of glutathione, increase the risk of gastric cancer, gene deletion, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0026] Example 1. Use of detection kits
[0027] 1. Extract DNA template
[0028] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.
[0029] 2. PCR amplification reaction
[0030] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0031] (1) MTHFR (C677T) forward primer: 5'CATCCCTCGCCTTGAACAG3'
[0032] MTHFR (C677T) reverse primer: 5'CAGACACTGTTGCTGGGTTTT3'
[0033] (2) TNF-β (A252G) forward primer: 5'CAGAAGGAGGAGGTGTAGGGT3'
[0034] TNF-β (A252G) reverse primer: 5'TTCGTGCTTTGGACTACCG 3'
[0035] (3) TNF-α (G-308A) forward primer: 5'GGAAGCCAAGACTGAAACCA3'
[0036] TNF-α (G-308A) reverse primer: 5' TCATCTGGAGGAAGCGGTAG 3'
[0037] (4) hMLH1 (T1151A) forward primer: 5'ACAGACTTTGCTACCAGGACTTG3'
[0038] hMLH1 (T1151A) reverse primer: 5'TGTCTTATTCCTCTGTGACAATG3'
[0039] The reaction system for PCR amplification is: 10×PCR reacti...
Embodiment 2
[0055] Example 2. Services for non-invasive detection of gastric cancer genes for the population
[0056] 1. Sampling and DNA extraction
[0057] The physicians in the laboratory department of the hospital will guide the subjects to use oral swabs to sample oral epithelial cells, and use the phenol-chloroform method to extract DNA from oral epithelial cells
[0058] 2. Genotype detection
[0059] Using the kit provided by the present invention, four single nucleotide polymorphisms of C677T on the MTHFR gene, A252G on the TNF-β gene, G-308A on the TNF-α gene, and T1151A on the hMLH1 gene of the subject’s genomic DNA The loci were subjected to DNA sequencing to determine the genotypes of the 4 SNPs loci.
[0060] 3. Risk assessment and analysis of gastric cancer high-risk groups
[0061] Through the analysis of the SNPs genotype of the subjects, a gastric cancer risk assessment and analysis report is issued. The report details the SNP site genetic detection information of C6...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com